Incidental Mutation 'R4592:Olfr1241'
ID342879
Institutional Source Beutler Lab
Gene Symbol Olfr1241
Ensembl Gene ENSMUSG00000075086
Gene Nameolfactory receptor 1241
SynonymsMOR231-14, GA_x6K02T2Q125-50926215-50925271
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89481314-89487126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89482756 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 126 (K126N)
Ref Sequence ENSEMBL: ENSMUSP00000149914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099778] [ENSMUST00000214743] [ENSMUST00000215055]
Predicted Effect probably damaging
Transcript: ENSMUST00000099778
AA Change: K126N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097366
Gene: ENSMUSG00000075086
AA Change: K126N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-46 PFAM
Pfam:7tm_1 39 285 8.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214743
AA Change: K126N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215055
AA Change: K126N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Olfr1241
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Olfr1241 APN 2 89482847 missense probably benign 0.38
IGL02175:Olfr1241 APN 2 89482282 missense possibly damaging 0.96
IGL02625:Olfr1241 APN 2 89482674 missense probably damaging 1.00
R0109:Olfr1241 UTSW 2 89482803 missense probably benign 0.10
R0109:Olfr1241 UTSW 2 89482803 missense probably benign 0.10
R1468:Olfr1241 UTSW 2 89482511 missense possibly damaging 0.94
R1468:Olfr1241 UTSW 2 89482511 missense possibly damaging 0.94
R1511:Olfr1241 UTSW 2 89482248 missense probably null 0.01
R1527:Olfr1241 UTSW 2 89482532 missense probably benign 0.10
R1528:Olfr1241 UTSW 2 89482553 missense probably damaging 1.00
R1585:Olfr1241 UTSW 2 89482971 missense probably benign 0.00
R2483:Olfr1241 UTSW 2 89483127 nonsense probably null
R2972:Olfr1241 UTSW 2 89482776 missense possibly damaging 0.52
R3692:Olfr1241 UTSW 2 89482896 missense probably benign
R4883:Olfr1241 UTSW 2 89482308 missense probably benign
R7104:Olfr1241 UTSW 2 89483114 missense possibly damaging 0.70
R7347:Olfr1241 UTSW 2 89482455 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCATTGGCAACCACAGTGAG -3'
(R):5'- GGATGCTGTTTATTCCACTGC -3'

Sequencing Primer
(F):5'- CTGTGCATGCAAGTCCTAATAATGGG -3'
(R):5'- GCTATCTCACCCAAGTTGATGGTAG -3'
Posted On2015-09-24