Incidental Mutation 'R4592:4933430I17Rik'
ID342887
Institutional Source Beutler Lab
Gene Symbol 4933430I17Rik
Ensembl Gene ENSMUSG00000058046
Gene NameRIKEN cDNA 4933430I17 gene
Synonyms
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62525369-62547993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62538927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 161 (V161E)
Ref Sequence ENSEMBL: ENSMUSP00000050465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062145]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062145
AA Change: V161E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050465
Gene: ENSMUSG00000058046
AA Change: V161E

DomainStartEndE-ValueType
Pfam:DUF4647 22 481 7.3e-182 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in 4933430I17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:4933430I17Rik APN 4 62532666 splice site probably benign
IGL00326:4933430I17Rik APN 4 62543744 splice site probably null
IGL01526:4933430I17Rik APN 4 62532621 missense possibly damaging 0.71
IGL02152:4933430I17Rik APN 4 62542754 missense possibly damaging 0.93
IGL03153:4933430I17Rik APN 4 62547326 missense possibly damaging 0.85
R0281:4933430I17Rik UTSW 4 62546067 nonsense probably null
R0436:4933430I17Rik UTSW 4 62543445 splice site probably benign
R1459:4933430I17Rik UTSW 4 62532341 missense probably damaging 0.99
R1807:4933430I17Rik UTSW 4 62542756 nonsense probably null
R1930:4933430I17Rik UTSW 4 62532282 missense possibly damaging 0.83
R1958:4933430I17Rik UTSW 4 62538909 missense probably benign 0.09
R2118:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R2119:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R2124:4933430I17Rik UTSW 4 62538872 missense possibly damaging 0.93
R4323:4933430I17Rik UTSW 4 62547311 missense probably damaging 0.98
R5708:4933430I17Rik UTSW 4 62525869 missense probably benign 0.01
R6576:4933430I17Rik UTSW 4 62532605 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCTGTGAGAAGTCCGGGTATTG -3'
(R):5'- AGCAAGTCGTGGTCACTTTC -3'

Sequencing Primer
(F):5'- AGTGCTCTTAACCACTGAGC -3'
(R):5'- GTCACTTTCTGTGTTTGGCCTGC -3'
Posted On2015-09-24