Incidental Mutation 'R4592:Slc4a7'
ID342921
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14778850 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 920 (G920S)
Ref Sequence ENSEMBL: ENSMUSP00000153323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225175] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225630] [ENSMUST00000225979] [ENSMUST00000226079]
Predicted Effect probably damaging
Transcript: ENSMUST00000057015
AA Change: G920S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: G920S

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223607
AA Change: G1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223695
AA Change: G933S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223740
AA Change: G926S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223761
AA Change: G1043S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223981
AA Change: G1045S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224049
AA Change: G913S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224222
AA Change: G1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224333
AA Change: G1051S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224672
AA Change: G1036S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224752
AA Change: G1037S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000224952
AA Change: G959S
Predicted Effect probably damaging
Transcript: ENSMUST00000225175
AA Change: G1030S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225232
AA Change: G823S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225238
AA Change: G940S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225496
Predicted Effect probably damaging
Transcript: ENSMUST00000225630
AA Change: G907S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225979
AA Change: G927S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226079
AA Change: G920S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.49 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1128:Slc4a7 UTSW 14 14733832 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4368:Slc4a7 UTSW 14 14733775 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6065:Slc4a7 UTSW 14 14739836 missense probably benign 0.29
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7378:Slc4a7 UTSW 14 14757421 missense probably damaging 1.00
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCTGTAGATCCACTGCCTC -3'
(R):5'- ACATGTGACCTTTCATTGGACG -3'

Sequencing Primer
(F):5'- GTAGATCCACTGCCTCTCAAATG -3'
(R):5'- GACCTTTCATTGGACGTTAGTAAGAG -3'
Posted On2015-09-24