Incidental Mutation 'R4558:Psd4'
ID342934
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Namepleckstrin and Sec7 domain containing 4
SynonymsSEC7 homolog, EFA6B
MMRRC Submission 042005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4558 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24367580-24414954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24404794 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 789 (V789M)
Ref Sequence ENSEMBL: ENSMUSP00000132395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000140303] [ENSMUST00000166388]
Predicted Effect probably damaging
Transcript: ENSMUST00000056641
AA Change: V789M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: V789M

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102942
AA Change: V789M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: V789M

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132924
Predicted Effect probably benign
Transcript: ENSMUST00000140303
Predicted Effect probably damaging
Transcript: ENSMUST00000166388
AA Change: V789M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: V789M

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Acot11 T C 4: 106,748,366 N583S probably damaging Het
Alox12 T G 11: 70,253,063 M164L probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Bmpr2 T A 1: 59,845,692 M279K probably damaging Het
Cacna2d3 T C 14: 29,103,713 T502A possibly damaging Het
Casp12 A T 9: 5,352,742 Y188F probably damaging Het
Catsperb A G 12: 101,591,540 Y790C possibly damaging Het
Cnbd1 G T 4: 19,055,095 N110K possibly damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Fam227b C T 2: 126,127,043 S37N probably benign Het
Fsip2 T C 2: 82,984,953 S3677P possibly damaging Het
Gm10764 A G 10: 87,290,820 noncoding transcript Het
H2-Q6 T C 17: 35,428,315 V312A probably benign Het
Hecw1 T A 13: 14,247,605 D972V probably damaging Het
Kalrn G A 16: 33,987,208 T2597I possibly damaging Het
Kng1 C A 16: 23,077,418 probably null Het
Med13 T C 11: 86,299,054 T1010A probably damaging Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Ncapg A T 5: 45,676,644 T341S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb4 A G 18: 37,309,964 I776V probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Pramef12 T C 4: 144,395,972 M1V probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Serpinb9c T A 13: 33,154,499 E139V probably benign Het
Sgsm1 G A 5: 113,258,111 probably benign Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Upf2 A G 2: 5,973,593 M423V unknown Het
Vmn1r207-ps A G 13: 22,726,411 noncoding transcript Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24394286 missense probably benign 0.25
IGL01302:Psd4 APN 2 24396787 critical splice donor site probably null
IGL01446:Psd4 APN 2 24405395 missense probably damaging 1.00
IGL01577:Psd4 APN 2 24403222 missense probably damaging 0.96
IGL01823:Psd4 APN 2 24394432 missense probably benign 0.27
IGL02103:Psd4 APN 2 24400528 nonsense probably null
IGL02212:Psd4 APN 2 24405314 nonsense probably null
IGL02240:Psd4 APN 2 24396377 missense probably benign 0.00
IGL02261:Psd4 APN 2 24401744 missense probably damaging 1.00
IGL02345:Psd4 APN 2 24401823 critical splice donor site probably null
IGL03272:Psd4 APN 2 24405680 splice site probably benign
bitcoin UTSW 2 24401557 missense probably damaging 1.00
underworld UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0132:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0278:Psd4 UTSW 2 24394438 missense probably damaging 1.00
R1303:Psd4 UTSW 2 24395018 missense probably benign 0.00
R1551:Psd4 UTSW 2 24403280 missense probably benign 0.02
R1715:Psd4 UTSW 2 24405332 missense probably damaging 1.00
R1854:Psd4 UTSW 2 24397456 missense probably benign 0.26
R1942:Psd4 UTSW 2 24405793 missense probably damaging 1.00
R2392:Psd4 UTSW 2 24394667 missense probably damaging 0.98
R2420:Psd4 UTSW 2 24401241 missense probably damaging 1.00
R4509:Psd4 UTSW 2 24396335 missense probably benign
R4512:Psd4 UTSW 2 24402889 missense probably damaging 1.00
R4995:Psd4 UTSW 2 24397247 missense probably benign
R5120:Psd4 UTSW 2 24405438 missense probably benign
R5314:Psd4 UTSW 2 24400516 missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24394885 missense probably benign
R5638:Psd4 UTSW 2 24397415 missense probably benign 0.14
R6191:Psd4 UTSW 2 24394487 missense probably damaging 1.00
R6224:Psd4 UTSW 2 24401557 missense probably damaging 1.00
R7024:Psd4 UTSW 2 24394543 missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24394973 missense probably benign 0.05
X0009:Psd4 UTSW 2 24401525 missense probably damaging 1.00
X0064:Psd4 UTSW 2 24404738 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTGACGGGAACAGTGTC -3'
(R):5'- GTTTCCTAGTCAAGATAGTAGCTCCC -3'

Sequencing Primer
(F):5'- GAACAGTGTCATTCTGGAACCATGC -3'
(R):5'- TAGTCAAGATAGTAGCTCCCATCAGG -3'
Posted On2015-09-24