Incidental Mutation 'R4558:Vmn1r207-ps'
ID342954
Institutional Source Beutler Lab
Gene Symbol Vmn1r207-ps
Ensembl Gene ENSMUSG00000084136
Gene Namevomeronasal 1 receptor 207, pseudogene
SynonymsGm11312
MMRRC Submission 042005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R4558 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22725646-22726718 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 22726411 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119931
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Acot11 T C 4: 106,748,366 N583S probably damaging Het
Alox12 T G 11: 70,253,063 M164L probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Bmpr2 T A 1: 59,845,692 M279K probably damaging Het
Cacna2d3 T C 14: 29,103,713 T502A possibly damaging Het
Casp12 A T 9: 5,352,742 Y188F probably damaging Het
Catsperb A G 12: 101,591,540 Y790C possibly damaging Het
Cnbd1 G T 4: 19,055,095 N110K possibly damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Fam227b C T 2: 126,127,043 S37N probably benign Het
Fsip2 T C 2: 82,984,953 S3677P possibly damaging Het
Gm10764 A G 10: 87,290,820 noncoding transcript Het
H2-Q6 T C 17: 35,428,315 V312A probably benign Het
Hecw1 T A 13: 14,247,605 D972V probably damaging Het
Kalrn G A 16: 33,987,208 T2597I possibly damaging Het
Kng1 C A 16: 23,077,418 probably null Het
Med13 T C 11: 86,299,054 T1010A probably damaging Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Ncapg A T 5: 45,676,644 T341S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb4 A G 18: 37,309,964 I776V probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Pramef12 T C 4: 144,395,972 M1V probably null Het
Psd4 G A 2: 24,404,794 V789M probably damaging Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Serpinb9c T A 13: 33,154,499 E139V probably benign Het
Sgsm1 G A 5: 113,258,111 probably benign Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Upf2 A G 2: 5,973,593 M423V unknown Het
Other mutations in Vmn1r207-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5441:Vmn1r207-ps UTSW 13 22726516 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTGATGGCATGGATTAAGTTCATAC -3'
(R):5'- AACTGTGGTTGGCACTCTG -3'

Sequencing Primer
(F):5'- AAGCATTGAGTATCCAAAAGTATAGG -3'
(R):5'- CACTCTGGGGAACATGTCTG -3'
Posted On2015-09-24