Incidental Mutation 'R4558:Kng1'
ID342958
Institutional Source Beutler Lab
Gene Symbol Kng1
Ensembl Gene ENSMUSG00000022875
Gene Namekininogen 1
SynonymsH-kininigen, L-kininogen
MMRRC Submission 042005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4558 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23057865-23082078 bp(+) (GRCm38)
Type of Mutationintron (37 bp from exon)
DNA Base Change (assembly) C to A at 23077418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023589] [ENSMUST00000039492] [ENSMUST00000089902]
Predicted Effect probably null
Transcript: ENSMUST00000023589
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039492
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089902
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136778
Meta Mutation Damage Score 0.638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and grossly unaffected with normal tail vein bleeding times, despite loss of detectable plasma kininogen. However, homozygotes show a significantly longer time to carotid artery occlusion after RoseBengal and laser-induced arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Acot11 T C 4: 106,748,366 N583S probably damaging Het
Alox12 T G 11: 70,253,063 M164L probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Bmpr2 T A 1: 59,845,692 M279K probably damaging Het
Cacna2d3 T C 14: 29,103,713 T502A possibly damaging Het
Casp12 A T 9: 5,352,742 Y188F probably damaging Het
Catsperb A G 12: 101,591,540 Y790C possibly damaging Het
Cnbd1 G T 4: 19,055,095 N110K possibly damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Fam227b C T 2: 126,127,043 S37N probably benign Het
Fsip2 T C 2: 82,984,953 S3677P possibly damaging Het
Gm10764 A G 10: 87,290,820 noncoding transcript Het
H2-Q6 T C 17: 35,428,315 V312A probably benign Het
Hecw1 T A 13: 14,247,605 D972V probably damaging Het
Kalrn G A 16: 33,987,208 T2597I possibly damaging Het
Med13 T C 11: 86,299,054 T1010A probably damaging Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Ncapg A T 5: 45,676,644 T341S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcdhb4 A G 18: 37,309,964 I776V probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Pramef12 T C 4: 144,395,972 M1V probably null Het
Psd4 G A 2: 24,404,794 V789M probably damaging Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Serpinb9c T A 13: 33,154,499 E139V probably benign Het
Sgsm1 G A 5: 113,258,111 probably benign Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Upf2 A G 2: 5,973,593 M423V unknown Het
Vmn1r207-ps A G 13: 22,726,411 noncoding transcript Het
Other mutations in Kng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Kng1 APN 16 23079194 missense probably benign 0.26
IGL01754:Kng1 APN 16 23079614 missense probably benign 0.10
IGL02049:Kng1 APN 16 23073437 missense probably damaging 0.99
IGL02138:Kng1 APN 16 23067808 missense probably damaging 0.99
IGL02216:Kng1 APN 16 23058533 missense probably damaging 0.98
IGL02230:Kng1 APN 16 23060494 critical splice donor site probably null
IGL02630:Kng1 APN 16 23079845 utr 3 prime probably benign
IGL03024:Kng1 APN 16 23074692 missense possibly damaging 0.92
R0518:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R0521:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R1352:Kng1 UTSW 16 23067694 critical splice acceptor site probably null
R1396:Kng1 UTSW 16 23078980 missense probably benign 0.00
R1514:Kng1 UTSW 16 23079760 missense probably damaging 0.97
R1753:Kng1 UTSW 16 23079119 missense possibly damaging 0.68
R2048:Kng1 UTSW 16 23058604 missense probably damaging 0.98
R2290:Kng1 UTSW 16 23079125 missense possibly damaging 0.79
R2357:Kng1 UTSW 16 23079065 missense possibly damaging 0.88
R3014:Kng1 UTSW 16 23079370 missense possibly damaging 0.72
R3607:Kng1 UTSW 16 23067802 missense probably damaging 1.00
R4322:Kng1 UTSW 16 23079520 missense probably benign
R4334:Kng1 UTSW 16 23079620 missense possibly damaging 0.88
R4388:Kng1 UTSW 16 23079318 missense possibly damaging 0.63
R4887:Kng1 UTSW 16 23067698 missense possibly damaging 0.71
R5115:Kng1 UTSW 16 23069282 missense possibly damaging 0.87
R5288:Kng1 UTSW 16 23079092 missense probably damaging 0.96
R5461:Kng1 UTSW 16 23079137 missense probably benign 0.19
R5894:Kng1 UTSW 16 23073363 missense probably benign 0.08
R6137:Kng1 UTSW 16 23074645 missense possibly damaging 0.56
R6260:Kng1 UTSW 16 23058621 missense possibly damaging 0.66
R6291:Kng1 UTSW 16 23079725 missense probably damaging 1.00
R6620:Kng1 UTSW 16 23081482 missense possibly damaging 0.74
R6947:Kng1 UTSW 16 23077374 missense probably benign 0.21
R7142:Kng1 UTSW 16 23079420 missense probably benign 0.25
R7166:Kng1 UTSW 16 23079678 missense probably benign 0.00
R7168:Kng1 UTSW 16 23079641 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCAGATTCTAACTTTGACCACAC -3'
(R):5'- TTGGAATAGACAGAACTGACCCC -3'

Sequencing Primer
(F):5'- GATTCTAACTTTGACCACACTGAAG -3'
(R):5'- TAGACAGAACTGACCCCAAGCTG -3'
Posted On2015-09-24