Mutagenetix > Incidental Mutation

Incidental Mutation 'R4558:Kalrn'

342959

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

E530005C20Rik, LOC224126, Hapip, 2210407G14Rik

MMRRC Submission

042005-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R4558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33789443-34393647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33807578 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2597 (T2597I)

Ref Sequence

ENSEMBL: ENSMUSP00000076088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]

AlphaFold

no structure available at present

PDB Structure

Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076810
AA Change: T2597I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: T2597I

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114973
AA Change: T928I

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: T928I

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART
IGc2	786	858	4.28e-12	SMART
FN3	872	954	3.07e-11	SMART
S_TKc	987	1241	1.28e-71	SMART

Meta Mutation Damage Score

0.1000

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017G19Rik	A	G	3: 40,567,240 (GRCm39)		noncoding transcript	Het
A830018L16Rik	C	A	1: 12,042,300 (GRCm39)	S440*	probably null	Het
Acot11	T	C	4: 106,605,563 (GRCm39)	N583S	probably damaging	Het
Alox12	T	G	11: 70,143,889 (GRCm39)	M164L	probably benign	Het
Atad2b	A	G	12: 4,993,223 (GRCm39)	I247M	probably benign	Het
Bmpr2	T	A	1: 59,884,851 (GRCm39)	M279K	probably damaging	Het
Cacna2d3	T	C	14: 28,825,670 (GRCm39)	T502A	possibly damaging	Het
Casp12	A	T	9: 5,352,742 (GRCm39)	Y188F	probably damaging	Het
Catsperb	A	G	12: 101,557,799 (GRCm39)	Y790C	possibly damaging	Het
Cnbd1	G	T	4: 19,055,095 (GRCm39)	N110K	possibly damaging	Het
Entrep1	G	A	19: 24,007,913 (GRCm39)	S130L	probably damaging	Het
Fam227b	C	T	2: 125,968,963 (GRCm39)	S37N	probably benign	Het
Fsip2	T	C	2: 82,815,297 (GRCm39)	S3677P	possibly damaging	Het
Gm10764	A	G	10: 87,126,682 (GRCm39)		noncoding transcript	Het
H2-Q6	T	C	17: 35,647,291 (GRCm39)	V312A	probably benign	Het
Hecw1	T	A	13: 14,422,190 (GRCm39)	D972V	probably damaging	Het
Kng1	C	A	16: 22,896,168 (GRCm39)		probably null	Het
Med13	T	C	11: 86,189,880 (GRCm39)	T1010A	probably damaging	Het
Nbeal1	C	T	1: 60,320,469 (GRCm39)	R2021*	probably null	Het
Ncapg	A	T	5: 45,833,986 (GRCm39)	T341S	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Pabir2	G	A	X: 52,349,554 (GRCm39)		probably benign	Het
Pcdhb4	A	G	18: 37,443,017 (GRCm39)	I776V	probably benign	Het
Ppp4r4	T	C	12: 103,573,192 (GRCm39)	V697A	probably benign	Het
Pramel13	T	C	4: 144,122,542 (GRCm39)	M1V	probably null	Het
Psd4	G	A	2: 24,294,806 (GRCm39)	V789M	probably damaging	Het
Rasa3	T	C	8: 13,648,259 (GRCm39)	E135G	probably damaging	Het
Serpinb9c	T	A	13: 33,338,482 (GRCm39)	E139V	probably benign	Het
Sgsm1	G	A	5: 113,405,977 (GRCm39)		probably benign	Het
Tmem161b	A	G	13: 84,399,363 (GRCm39)	I6M	possibly damaging	Het
Upf2	A	G	2: 5,978,404 (GRCm39)	M423V	unknown	Het
Vmn1r207	A	G	13: 22,910,581 (GRCm39)		noncoding transcript	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	33,996,092 (GRCm39)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,082,999 (GRCm39)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,055,700 (GRCm39)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,114,531 (GRCm39)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,018,882 (GRCm39)	splice site	probably null
IGL02059:Kalrn	APN	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,040,592 (GRCm39)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,130,897 (GRCm39)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,152,594 (GRCm39)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,181,216 (GRCm39)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,334,329 (GRCm39)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,040,484 (GRCm39)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,212,420 (GRCm39)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,040,500 (GRCm39)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,134,562 (GRCm39)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,205,667 (GRCm39)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,134,546 (GRCm39)	missense	probably damaging	0.99
breeze	UTSW	16	33,834,045 (GRCm39)	missense
ethereal	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
Feather	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
Hidden	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
Soulful	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,018,884 (GRCm39)	splice site	probably benign
R0043:Kalrn	UTSW	16	33,875,276 (GRCm39)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,177,541 (GRCm39)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	33,851,960 (GRCm39)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	33,870,306 (GRCm39)	intron	probably benign
R0183:Kalrn	UTSW	16	33,991,749 (GRCm39)	splice site	probably null
R0422:Kalrn	UTSW	16	34,134,643 (GRCm39)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	33,875,261 (GRCm39)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,814,040 (GRCm39)	splice site	probably benign
R0656:Kalrn	UTSW	16	33,852,837 (GRCm39)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	33,936,778 (GRCm39)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	33,830,951 (GRCm39)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	33,855,924 (GRCm39)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	33,870,289 (GRCm39)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,205,760 (GRCm39)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	33,836,868 (GRCm39)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,809,173 (GRCm39)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,033,190 (GRCm39)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,796,124 (GRCm39)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	33,994,857 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,134,648 (GRCm39)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	33,830,918 (GRCm39)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,181,320 (GRCm39)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,033,243 (GRCm39)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,114,585 (GRCm39)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,177,331 (GRCm39)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,796,293 (GRCm39)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,797,894 (GRCm39)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	33,848,415 (GRCm39)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,010,106 (GRCm39)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,072,680 (GRCm39)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,152,513 (GRCm39)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,152,600 (GRCm39)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,128,094 (GRCm39)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	33,829,632 (GRCm39)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	33,996,632 (GRCm39)	splice site	probably null
R2404:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,130,865 (GRCm39)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,032,642 (GRCm39)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,177,685 (GRCm39)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,212,400 (GRCm39)	splice site	probably null
R3788:Kalrn	UTSW	16	34,040,610 (GRCm39)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	33,860,259 (GRCm39)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,024,226 (GRCm39)	splice site	probably null
R3934:Kalrn	UTSW	16	34,130,901 (GRCm39)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,055,761 (GRCm39)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4572:Kalrn	UTSW	16	34,212,412 (GRCm39)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,055,637 (GRCm39)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,334,296 (GRCm39)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	33,849,075 (GRCm39)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	33,996,761 (GRCm39)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,018,857 (GRCm39)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,177,339 (GRCm39)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,334,389 (GRCm39)	unclassified	probably benign
R4888:Kalrn	UTSW	16	33,991,700 (GRCm39)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,177,785 (GRCm39)	splice site	probably null
R5030:Kalrn	UTSW	16	33,796,112 (GRCm39)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,134,722 (GRCm39)	nonsense	probably null
R5117:Kalrn	UTSW	16	33,853,971 (GRCm39)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,083,023 (GRCm39)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	33,873,992 (GRCm39)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	33,996,150 (GRCm39)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	33,860,304 (GRCm39)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	33,834,454 (GRCm39)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	33,836,949 (GRCm39)	missense	probably benign
R5716:Kalrn	UTSW	16	33,807,546 (GRCm39)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,796,190 (GRCm39)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,032,619 (GRCm39)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,807,461 (GRCm39)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,064,203 (GRCm39)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,177,713 (GRCm39)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	33,830,950 (GRCm39)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,181,255 (GRCm39)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,805,561 (GRCm39)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,033,255 (GRCm39)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,177,481 (GRCm39)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	33,874,009 (GRCm39)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	33,875,441 (GRCm39)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,796,361 (GRCm39)	missense	probably benign
R6397:Kalrn	UTSW	16	33,813,355 (GRCm39)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,152,534 (GRCm39)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,025,672 (GRCm39)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,181,354 (GRCm39)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,003,117 (GRCm39)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,038,293 (GRCm39)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,796,073 (GRCm39)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,040,506 (GRCm39)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,177,418 (GRCm39)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,038,261 (GRCm39)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,076,597 (GRCm39)	missense	unknown
R7154:Kalrn	UTSW	16	34,032,527 (GRCm39)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	33,983,447 (GRCm39)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	33,996,792 (GRCm39)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	33,996,131 (GRCm39)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,076,603 (GRCm39)	missense	unknown
R7563:Kalrn	UTSW	16	34,212,464 (GRCm39)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,134,582 (GRCm39)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,810,161 (GRCm39)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,809,217 (GRCm39)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	33,849,122 (GRCm39)	missense	probably benign
R8080:Kalrn	UTSW	16	33,796,038 (GRCm39)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	33,875,414 (GRCm39)	missense	probably benign
R8239:Kalrn	UTSW	16	33,870,153 (GRCm39)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	33,855,431 (GRCm39)	nonsense	probably null
R8294:Kalrn	UTSW	16	33,853,954 (GRCm39)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,181,305 (GRCm39)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	33,854,884 (GRCm39)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,803,225 (GRCm39)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,018,830 (GRCm39)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,038,305 (GRCm39)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,814,025 (GRCm39)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,047,496 (GRCm39)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	33,854,854 (GRCm39)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,181,371 (GRCm39)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	33,834,045 (GRCm39)	missense
R9424:Kalrn	UTSW	16	33,809,188 (GRCm39)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	33,916,249 (GRCm39)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,805,600 (GRCm39)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	33,849,197 (GRCm39)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,032,583 (GRCm39)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	33,860,303 (GRCm39)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	33,855,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTGCTTCCATTGGCTAG -3'
(R):5'- GGTCAATTTCTTGCACCTGCTG -3'

Sequencing Primer
(F):5'- CCATTGGCTAGCTGTCCTTGG -3'
(R):5'- GTTGGCCTGCAGACTTTCACAG -3'

Posted On

2015-09-24