Incidental Mutation 'R4560:Cog8'
ID343046
Institutional Source Beutler Lab
Gene Symbol Cog8
Ensembl Gene ENSMUSG00000031916
Gene Namecomponent of oligomeric golgi complex 8
SynonymsC87832
Accession Numbers

Genbank: NM_139229; MGI: 2142885

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107046289-107056689 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 107052211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034391] [ENSMUST00000034392] [ENSMUST00000055316] [ENSMUST00000095517] [ENSMUST00000170962]
Predicted Effect probably null
Transcript: ENSMUST00000034391
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034392
SMART Domains Protein: ENSMUSP00000034392
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PUA 95 170 4.36e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055316
SMART Domains Protein: ENSMUSP00000138676
Gene: ENSMUSG00000078931

DomainStartEndE-ValueType
Pfam:Pep_deformylase 52 222 2.3e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095517
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122903
Predicted Effect probably benign
Transcript: ENSMUST00000134772
Predicted Effect probably benign
Transcript: ENSMUST00000170962
SMART Domains Protein: ENSMUSP00000126153
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PDB:1T5Y|A 1 133 7e-87 PDB
Blast:PUA 95 123 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212281
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the conserved oligomeric Golgi (COG) complex, a multiprotein complex that plays a structural role in the Golgi apparatus, and is involved in intracellular membrane trafficking and glycoprotein modification. Mutations in this gene cause congenital disorder of glycosylation, type IIh, a disease that is characterized by under-glycosylated serum proteins, and whose symptoms include severe psychomotor retardation, failure to thrive, seizures, and dairy and wheat product intolerance. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in Cog8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Cog8 APN 8 107054065 missense probably benign 0.23
IGL01959:Cog8 APN 8 107056378 missense probably damaging 1.00
IGL02563:Cog8 APN 8 107056423 missense possibly damaging 0.70
IGL02961:Cog8 APN 8 107056253 unclassified probably benign
R0076:Cog8 UTSW 8 107054133 missense possibly damaging 0.96
R0255:Cog8 UTSW 8 107049145 unclassified probably benign
R0433:Cog8 UTSW 8 107056478 missense possibly damaging 0.52
R0990:Cog8 UTSW 8 107052487 unclassified probably null
R1457:Cog8 UTSW 8 107052896 missense probably damaging 1.00
R1567:Cog8 UTSW 8 107054108 nonsense probably null
R2239:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2380:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2910:Cog8 UTSW 8 107054221 missense probably benign 0.25
R3978:Cog8 UTSW 8 107053037 missense probably damaging 1.00
R4863:Cog8 UTSW 8 107050174 missense probably damaging 1.00
R4879:Cog8 UTSW 8 107056352 missense probably damaging 0.99
R5026:Cog8 UTSW 8 107049125 missense probably benign
R5721:Cog8 UTSW 8 107050148 missense probably benign 0.00
R6489:Cog8 UTSW 8 107050301 missense probably benign 0.00
T0722:Cog8 UTSW 8 107048993 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTACTCTATCATAGCTTCTTCCAGG -3'
(R):5'- ATCCTGGGCAGCAGTAACAC -3'

Sequencing Primer
(F):5'- ATCATAGCTTCTTCCAGGATCCC -3'
(R):5'- GCAGCAGTAACACGCCTG -3'
Posted On2015-09-24