Incidental Mutation 'R4560:1700014D04Rik'
ID343059
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene NameRIKEN cDNA 1700014D04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59740842-59746752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59741757 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 750 (S750P)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
Predicted Effect probably benign
Transcript: ENSMUST00000055343
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180139
AA Change: S750P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: S750P

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A C 14: 55,778,950 probably null Het
Atp8b1 A T 18: 64,556,879 L594* probably null Het
Atp8b1 C T 18: 64,568,247 V347I probably benign Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 unclassified probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATTTGGGCAACGACAG -3'
(R):5'- TGATACTCAAGGCCAGGGAG -3'

Sequencing Primer
(F):5'- AACGACAGTCTCTTCTGAGCTGG -3'
(R):5'- GATGAGAGTCTATCAAGCCCCCTG -3'
Posted On2015-09-24