Incidental Mutation 'R4560:Atp8b1'
ID343068
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4560 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 64556879 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 594 (L594*)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably null
Transcript: ENSMUST00000025482
AA Change: L594*
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: L594*

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,757 S750P probably damaging Het
Adcy4 A C 14: 55,778,950 probably null Het
Axin1 A G 17: 26,173,771 D342G probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Capn10 T C 1: 92,939,362 Y105H probably damaging Het
Ccdc89 T G 7: 90,427,128 L182R probably damaging Het
Cdk5rap2 A G 4: 70,315,331 F537S probably benign Het
Cidec A T 6: 113,428,438 M118K probably damaging Het
Cog8 A T 8: 107,052,211 probably null Het
Ctif A T 18: 75,519,881 L435Q probably damaging Het
Dhx9 A G 1: 153,467,157 V533A probably damaging Het
Drc1 T A 5: 30,363,097 M594K probably benign Het
Dthd1 C T 5: 62,827,092 T380I probably damaging Het
Fat2 A G 11: 55,265,951 S3475P possibly damaging Het
G6pd2 G A 5: 61,810,343 R487H possibly damaging Het
Hcrtr2 A G 9: 76,254,688 V140A probably damaging Het
Ikbke C T 1: 131,272,120 C243Y probably damaging Het
Il21 C A 3: 37,225,484 E128* probably null Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Me3 G T 7: 89,849,730 R506L probably benign Het
Mtf2 T A 5: 108,086,989 probably null Het
Nbas A G 12: 13,583,527 N2311S probably benign Het
Nomo1 G T 7: 46,041,480 V97L probably damaging Het
Pcdhb11 G A 18: 37,423,734 V706I possibly damaging Het
Pkhd1 G A 1: 20,211,858 R2920C probably damaging Het
Prox2 T C 12: 85,095,043 T129A probably benign Het
Rgs18 T G 1: 144,755,982 I131L probably benign Het
Rnf19b G T 4: 129,071,823 C57F probably damaging Het
Rpl11 T C 4: 136,051,211 Y122C probably damaging Het
Sarnp A G 10: 128,846,543 K5R probably damaging Het
Scg2 A T 1: 79,435,181 H568Q probably damaging Het
Sept10 T C 10: 59,183,595 Y150C probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Smco2 T A 6: 146,871,176 V292D possibly damaging Het
Smok3c A G 5: 138,064,484 M78V probably benign Het
Spag16 C A 1: 69,844,296 F61L probably benign Het
Spata22 G A 11: 73,345,759 R297H probably damaging Het
Syt3 C A 7: 44,395,944 P536Q probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Trim9 A C 12: 70,347,118 Y17* probably null Het
Tsga10 A G 1: 37,807,082 M321T probably benign Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Ubxn1 C T 19: 8,874,224 T207I probably benign Het
Vmn2r117 A T 17: 23,459,877 V791D probably damaging Het
Vps54 C G 11: 21,312,260 C785W possibly damaging Het
Zfp616 A G 11: 74,083,034 D43G probably benign Het
Zfp952 A G 17: 33,003,954 H469R probably benign Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGAAATCTGGACACTCTC -3'
(R):5'- TTTCTCCACAGTGTGCTGAGC -3'

Sequencing Primer
(F):5'- CTGGACACTCTCAGAAGTCAATTGTC -3'
(R):5'- ACAGTGTGCTGAGCCCTAC -3'
Posted On2015-09-24