Incidental Mutation 'R4561:Ttc21b'
ID343078
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Nametetratricopeptide repeat domain 21B
Synonymsline 158, Thm1, aln, 2410066K11Rik
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66184327-66256617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66186218 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1269 (Y1269C)
Ref Sequence ENSEMBL: ENSMUSP00000099779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
Predicted Effect probably damaging
Transcript: ENSMUST00000102718
AA Change: Y1269C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: Y1269C

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125446
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128859
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
PIT4696001:Ttc21b UTSW 2 66231219 intron probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0440:Ttc21b UTSW 2 66236382 missense probably benign 0.03
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3847:Ttc21b UTSW 2 66242679 missense probably damaging 1.00
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6210:Ttc21b UTSW 2 66236354 missense probably benign 0.00
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6456:Ttc21b UTSW 2 66188331 missense probably damaging 0.97
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGTGACATTTGAGAGTAGAAGG -3'
(R):5'- CCACTTGTCTGCTGATGGAG -3'

Sequencing Primer
(F):5'- GTAGAAGGAAATTGTGCATTGCTAC -3'
(R):5'- CTGAAGAAGCCACACTCGGG -3'
Posted On2015-09-24