Incidental Mutation 'R4561:Olfr996'
ID343079
Institutional Source Beutler Lab
Gene Symbol Olfr996
Ensembl Gene ENSMUSG00000111179
Gene Nameolfactory receptor 996
SynonymsGA_x6K02T2Q125-47058060-47059004, MOR175-4
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85579215-85580282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85579620 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 127 (C127F)
Ref Sequence ENSEMBL: ENSMUSP00000076330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077075]
Predicted Effect probably damaging
Transcript: ENSMUST00000077075
AA Change: C127F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076330
Gene: ENSMUSG00000111179
AA Change: C127F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-52 PFAM
Pfam:7tm_1 41 290 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Olfr996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Olfr996 APN 2 85579531 nonsense probably null
IGL01972:Olfr996 APN 2 85579773 missense probably damaging 1.00
IGL02102:Olfr996 APN 2 85579673 missense probably damaging 0.98
IGL03159:Olfr996 APN 2 85579940 missense probably damaging 0.99
R0539:Olfr996 UTSW 2 85579775 missense probably damaging 0.99
R4275:Olfr996 UTSW 2 85579863 missense probably benign 0.07
R4953:Olfr996 UTSW 2 85579725 nonsense probably null
R5794:Olfr996 UTSW 2 85579341 missense probably benign 0.03
R6061:Olfr996 UTSW 2 85579542 missense possibly damaging 0.48
R6695:Olfr996 UTSW 2 85579449 missense probably damaging 1.00
R6981:Olfr996 UTSW 2 85579481 missense probably benign 0.06
R7030:Olfr996 UTSW 2 85579402 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGCTGCACACACCTATGTAC -3'
(R):5'- TGTCAGAACATGCTAGAGACAGC -3'

Sequencing Primer
(F):5'- CAGCCAACTGTCTTTTGTAGATG -3'
(R):5'- CAGCAATGGGGAAATGTCAC -3'
Posted On2015-09-24