Incidental Mutation 'R4561:Arnt'
ID343081
Institutional Source Beutler Lab
Gene Symbol Arnt
Ensembl Gene ENSMUSG00000015522
Gene Namearyl hydrocarbon receptor nuclear translocator
SynonymsESTM42, Hif1b, D3Ertd557e, bHLHe2
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95434388-95497240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95452613 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 56 (N56D)
Ref Sequence ENSEMBL: ENSMUSP00000102778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107160] [ENSMUST00000107161]
Predicted Effect probably benign
Transcript: ENSMUST00000015666
AA Change: N56D

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522
AA Change: N56D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 69 128 2.9e-11 SMART
PAS 143 210 7.4e-13 SMART
low complexity region 231 242 N/A INTRINSIC
PAS 332 397 7.6e-10 SMART
PAC 404 447 9.6e-7 SMART
low complexity region 705 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090804
AA Change: N56D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522
AA Change: N56D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102749
AA Change: N56D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522
AA Change: N56D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 95 148 1e-14 SMART
PAS 163 230 1.51e-10 SMART
low complexity region 251 262 N/A INTRINSIC
PAS 352 417 1.55e-7 SMART
PAC 424 467 1.95e-4 SMART
low complexity region 725 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107160
AA Change: N56D

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102778
Gene: ENSMUSG00000015522
AA Change: N56D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
AA Change: N56D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522
AA Change: N56D

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149051
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Arnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Arnt APN 3 95490340 missense probably damaging 0.98
IGL00949:Arnt APN 3 95487268 missense probably damaging 1.00
IGL01304:Arnt APN 3 95448385 missense probably damaging 1.00
IGL01634:Arnt APN 3 95470398 splice site probably benign
IGL01685:Arnt APN 3 95474681 missense probably damaging 1.00
IGL01768:Arnt APN 3 95491016 unclassified probably benign
IGL02738:Arnt APN 3 95495320 unclassified probably null
IGL02941:Arnt APN 3 95460370 splice site probably benign
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0420:Arnt UTSW 3 95470394 splice site probably benign
R0801:Arnt UTSW 3 95493846 missense possibly damaging 0.86
R1418:Arnt UTSW 3 95470399 splice site probably benign
R1523:Arnt UTSW 3 95489654 missense possibly damaging 0.77
R1956:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1957:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1958:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1969:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1970:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1971:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R3743:Arnt UTSW 3 95474705 missense possibly damaging 0.49
R4780:Arnt UTSW 3 95488385 missense probably damaging 1.00
R4827:Arnt UTSW 3 95489913 unclassified probably null
R4913:Arnt UTSW 3 95490654 missense probably damaging 1.00
R5051:Arnt UTSW 3 95470337 missense probably benign 0.08
R5572:Arnt UTSW 3 95474704 missense possibly damaging 0.49
R5866:Arnt UTSW 3 95490726 unclassified probably benign
R6376:Arnt UTSW 3 95490625 missense probably damaging 0.99
R6491:Arnt UTSW 3 95476143 missense probably damaging 1.00
R6873:Arnt UTSW 3 95474575 missense probably damaging 1.00
R6920:Arnt UTSW 3 95490621 missense probably damaging 0.99
X0020:Arnt UTSW 3 95494565 missense probably benign 0.10
X0026:Arnt UTSW 3 95474630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGTTGTAATACTATGAAAAGC -3'
(R):5'- AGCATATTCTTTAGGACAATGCCC -3'

Sequencing Primer
(F):5'- ATAGACATGTTTTTGTTTTGCTTCTG -3'
(R):5'- AGCTACATTCCCAGCTGGTG -3'
Posted On2015-09-24