Incidental Mutation 'R4561:Calr4'
ID343083
Institutional Source Beutler Lab
Gene Symbol Calr4
Ensembl Gene ENSMUSG00000028558
Gene Namecalreticulin 4
Synonyms4933403L16Rik
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109234485-109254571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109246182 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 163 (N163S)
Ref Sequence ENSEMBL: ENSMUSP00000102242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030285] [ENSMUST00000106628] [ENSMUST00000106629] [ENSMUST00000106631]
Predicted Effect probably damaging
Transcript: ENSMUST00000030285
AA Change: N270S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030285
Gene: ENSMUSG00000028558
AA Change: N270S

DomainStartEndE-ValueType
Pfam:Calreticulin 11 246 7e-61 PFAM
Pfam:Calreticulin 243 318 1.7e-21 PFAM
coiled coil region 336 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106628
AA Change: N163S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102239
Gene: ENSMUSG00000028558
AA Change: N163S

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106629
AA Change: N163S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102240
Gene: ENSMUSG00000028558
AA Change: N163S

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106631
AA Change: N163S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102242
Gene: ENSMUSG00000028558
AA Change: N163S

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141555
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Calr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Calr4 APN 4 109244115 missense probably damaging 1.00
IGL01392:Calr4 APN 4 109253874 missense probably benign 0.41
IGL01676:Calr4 APN 4 109244250 missense probably damaging 0.99
IGL02587:Calr4 APN 4 109238937 missense possibly damaging 0.76
PIT4576001:Calr4 UTSW 4 109235856 missense possibly damaging 0.82
R0525:Calr4 UTSW 4 109242264 splice site probably benign
R1444:Calr4 UTSW 4 109246241 missense possibly damaging 0.76
R1899:Calr4 UTSW 4 109246293 critical splice donor site probably null
R5001:Calr4 UTSW 4 109238982 critical splice donor site probably null
R5014:Calr4 UTSW 4 109235797 nonsense probably null
R5088:Calr4 UTSW 4 109244662 intron probably benign
R5267:Calr4 UTSW 4 109244076 missense probably damaging 1.00
R6175:Calr4 UTSW 4 109244245 missense probably benign 0.03
R6262:Calr4 UTSW 4 109251367 missense probably damaging 1.00
R6795:Calr4 UTSW 4 109244788 missense probably damaging 1.00
R7099:Calr4 UTSW 4 109242229 missense probably benign 0.01
R7202:Calr4 UTSW 4 109244057 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAACTTGGAAGAGTCTTATGCC -3'
(R):5'- GTCTCTAACGTCAGGTTGGG -3'

Sequencing Primer
(F):5'- TCTGTACAGCTCTGTAGACCAGG -3'
(R):5'- CTAACGTCAGGTTGGGGCTTG -3'
Posted On2015-09-24