Incidental Mutation 'R4561:Cep135'
ID343086
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76638193 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1048 (H1048Y)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049060
AA Change: H1048Y

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: H1048Y

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121979
AA Change: H1048Y

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: H1048Y

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGACTAAGCCTAAACTTTTGCTG -3'
(R):5'- ACGTCTACGGCTTCAAACCC -3'

Sequencing Primer
(F):5'- AAGCCTAAACTTTTGCTGAATTAATC -3'
(R):5'- TGTCCAGACGCAGCAGTTAG -3'
Posted On2015-09-24