Incidental Mutation 'R4561:Kcnd2'
ID343089
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Namepotassium voltage-gated channel, Shal-related family, member 2
SynonymsKv4.2
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location21215503-21729805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21216396 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 33 (Q33R)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
Predicted Effect probably benign
Transcript: ENSMUST00000081542
AA Change: Q33R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: Q33R

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21714154 missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21217217 missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21727340 makesense probably null
IGL01534:Kcnd2 APN 6 21726145 missense probably benign
IGL02623:Kcnd2 APN 6 21726195 missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21216925 nonsense probably null
IGL02874:Kcnd2 APN 6 21216923 missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21217149 missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21216555 missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21216509 nonsense probably null
IGL03154:Kcnd2 APN 6 21216708 missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21216516 missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21714209 missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21216683 missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21216442 missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21726239 splice site probably benign
R0836:Kcnd2 UTSW 6 21727329 missense probably damaging 1.00
R0884:Kcnd2 UTSW 6 21216541 missense probably benign
R1434:Kcnd2 UTSW 6 21216357 missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21216432 missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21217263 nonsense probably null
R3939:Kcnd2 UTSW 6 21217096 missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21216897 missense probably damaging 0.99
R4707:Kcnd2 UTSW 6 21723212 missense probably benign
R5523:Kcnd2 UTSW 6 21723212 missense probably benign
R5545:Kcnd2 UTSW 6 21217019 missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21217085 missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21216588 missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21216708 missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21216178 start gained probably benign
R7183:Kcnd2 UTSW 6 21216437 missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21216778 missense probably benign 0.28
X0021:Kcnd2 UTSW 6 21217323 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCCTGAGGTGAAGAAGTG -3'
(R):5'- ATAGTGAAGCTTCCCCGTGC -3'

Sequencing Primer
(F):5'- CTTCCAGACAACATGGCA -3'
(R):5'- TCCCCGTGCGGTAGAAGTTG -3'
Posted On2015-09-24