Incidental Mutation 'R4561:Slco1b2'
ID343097
Institutional Source Beutler Lab
Gene Symbol Slco1b2
Ensembl Gene ENSMUSG00000030236
Gene Namesolute carrier organic anion transporter family, member 1b2
Synonyms7330442B20Rik, Slc21a6, mlst-1, Oatp1b2, Slc21a10
MMRRC Submission 041786-MU
Accession Numbers

Genbank: NM_020495; MGI: 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141629518-141686646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141671167 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 409 (T409A)
Ref Sequence ENSEMBL: ENSMUSP00000044326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042812] [ENSMUST00000203597]
Predicted Effect probably benign
Transcript: ENSMUST00000042812
AA Change: T409A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044326
Gene: ENSMUSG00000030236
AA Change: T409A

DomainStartEndE-ValueType
Pfam:MFS_1 27 443 6.1e-21 PFAM
KAZAL 457 501 8.81e-4 SMART
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203597
SMART Domains Protein: ENSMUSP00000144747
Gene: ENSMUSG00000030236

DomainStartEndE-ValueType
Pfam:MFS_1 27 405 8.4e-19 PFAM
KAZAL 422 466 5.7e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 534 556 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null mutation display slight abnormalities in blood chemistry and are resistant to injury induced by some classes of hepatotoxins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Slco1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Slco1b2 APN 6 141655352 missense probably damaging 0.99
IGL01583:Slco1b2 APN 6 141663672 missense possibly damaging 0.85
IGL01909:Slco1b2 APN 6 141648586 missense probably damaging 1.00
IGL01943:Slco1b2 APN 6 141676286 missense possibly damaging 0.71
IGL01952:Slco1b2 APN 6 141671230 missense probably benign 0.01
IGL02186:Slco1b2 APN 6 141634545 splice site probably benign
IGL02309:Slco1b2 APN 6 141672281 missense probably damaging 1.00
IGL02352:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02359:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02524:Slco1b2 APN 6 141671072 missense probably benign 0.03
IGL02701:Slco1b2 APN 6 141685545 missense probably benign 0.35
IGL02962:Slco1b2 APN 6 141648553 missense probably damaging 0.99
3-1:Slco1b2 UTSW 6 141669463 missense probably benign 0.01
IGL03052:Slco1b2 UTSW 6 141648585 missense probably benign 0.13
R0112:Slco1b2 UTSW 6 141671111 missense probably benign 0.30
R0116:Slco1b2 UTSW 6 141669388 missense probably benign 0.22
R0515:Slco1b2 UTSW 6 141669410 missense possibly damaging 0.74
R0831:Slco1b2 UTSW 6 141685446 missense probably benign 0.01
R0965:Slco1b2 UTSW 6 141685596 missense probably damaging 1.00
R1115:Slco1b2 UTSW 6 141683254 missense probably benign 0.03
R1452:Slco1b2 UTSW 6 141672200 missense probably benign 0.02
R1630:Slco1b2 UTSW 6 141656821 missense probably damaging 0.99
R1885:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1886:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1975:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R2394:Slco1b2 UTSW 6 141669374 missense probably damaging 0.99
R3408:Slco1b2 UTSW 6 141676256 missense probably benign 0.01
R3793:Slco1b2 UTSW 6 141676307 missense probably damaging 1.00
R4560:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4563:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4807:Slco1b2 UTSW 6 141669469 missense probably damaging 1.00
R4820:Slco1b2 UTSW 6 141685432 missense probably benign 0.05
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4889:Slco1b2 UTSW 6 141656743 intron probably benign
R4914:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4918:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4977:Slco1b2 UTSW 6 141657557 missense probably benign 0.01
R5607:Slco1b2 UTSW 6 141685586 missense probably benign
R6082:Slco1b2 UTSW 6 141663670 missense probably benign 0.08
R6118:Slco1b2 UTSW 6 141657510 missense probably benign 0.03
R6522:Slco1b2 UTSW 6 141655419 critical splice donor site probably null
R7054:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R7182:Slco1b2 UTSW 6 141656930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTCGTTTCTAGTTTAGAAGC -3'
(R):5'- GCTCTTGGGAGATCTTAAACAGTG -3'

Sequencing Primer
(F):5'- CGTTTCTAGTTTAGAAGCAACAGAAC -3'
(R):5'- TCCTTACTAACTGAACAATTTAGTGG -3'
Posted On2015-09-24