Incidental Mutation 'R4561:Nlrc5'
ID343101
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94477146 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 625 (T625A)
Ref Sequence ENSEMBL: ENSMUSP00000148677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
Predicted Effect probably damaging
Transcript: ENSMUST00000053085
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: T625A

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182409
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000183132
Predicted Effect probably damaging
Transcript: ENSMUST00000211816
AA Change: T625A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7204:Nlrc5 UTSW 8 94491525 missense possibly damaging 0.83
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7368:Nlrc5 UTSW 8 94476393 nonsense probably null
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AAAGGTAGACTGGGCCTCTC -3'
(R):5'- GACTCACCTGAGATTCTCCAC -3'

Sequencing Primer
(F):5'- TAGACTGGGCCTCTCGGATCATC -3'
(R):5'- GAGATTCTCCACCTGCCCAC -3'
Posted On2015-09-24