Incidental Mutation 'R4561:Zfp236'
ID343115
Institutional Source Beutler Lab
Gene Symbol Zfp236
Ensembl Gene ENSMUSG00000041258
Gene Namezinc finger protein 236
SynonymsLOC240456
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location82593593-82692883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82620406 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1363 (I1363N)
Ref Sequence ENSEMBL: ENSMUSP00000138557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171071] [ENSMUST00000182122] [ENSMUST00000183048]
Predicted Effect probably damaging
Transcript: ENSMUST00000171071
AA Change: I1315N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130004
Gene: ENSMUSG00000041258
AA Change: I1315N

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
low complexity region 290 309 N/A INTRINSIC
low complexity region 403 426 N/A INTRINSIC
ZnF_C2H2 436 458 1.98e-4 SMART
ZnF_C2H2 464 486 9.58e-3 SMART
ZnF_C2H2 492 514 6.42e-4 SMART
ZnF_C2H2 520 542 1.18e-2 SMART
low complexity region 592 605 N/A INTRINSIC
ZnF_C2H2 611 633 1.62e0 SMART
ZnF_C2H2 639 661 5.21e-4 SMART
ZnF_C2H2 667 689 6.78e-3 SMART
ZnF_C2H2 695 717 7.37e-4 SMART
low complexity region 720 733 N/A INTRINSIC
ZnF_C2H2 922 944 5.21e-4 SMART
ZnF_C2H2 950 972 1.04e-3 SMART
ZnF_C2H2 978 1000 8.6e-5 SMART
ZnF_C2H2 1006 1028 2.75e-3 SMART
low complexity region 1030 1039 N/A INTRINSIC
ZnF_C2H2 1122 1144 7.78e-3 SMART
ZnF_C2H2 1150 1172 3.63e-3 SMART
ZnF_C2H2 1178 1200 6.88e-4 SMART
ZnF_C2H2 1206 1228 5.42e-2 SMART
low complexity region 1243 1258 N/A INTRINSIC
low complexity region 1462 1477 N/A INTRINSIC
ZnF_C2H2 1612 1635 7.15e-2 SMART
ZnF_C2H2 1641 1663 2.91e-2 SMART
ZnF_C2H2 1677 1699 7.26e-3 SMART
ZnF_C2H2 1705 1727 1.84e-4 SMART
ZnF_C2H2 1733 1756 2.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182122
AA Change: I1363N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138557
Gene: ENSMUSG00000041258
AA Change: I1363N

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
ZnF_C2H2 484 506 1.98e-4 SMART
ZnF_C2H2 512 534 9.58e-3 SMART
ZnF_C2H2 540 562 6.42e-4 SMART
ZnF_C2H2 568 590 1.18e-2 SMART
low complexity region 640 653 N/A INTRINSIC
ZnF_C2H2 659 681 1.62e0 SMART
ZnF_C2H2 687 709 5.21e-4 SMART
ZnF_C2H2 715 737 6.78e-3 SMART
ZnF_C2H2 743 765 7.37e-4 SMART
low complexity region 768 781 N/A INTRINSIC
ZnF_C2H2 970 992 5.21e-4 SMART
ZnF_C2H2 998 1020 1.04e-3 SMART
ZnF_C2H2 1026 1048 8.6e-5 SMART
ZnF_C2H2 1054 1076 2.75e-3 SMART
low complexity region 1078 1087 N/A INTRINSIC
ZnF_C2H2 1170 1192 7.78e-3 SMART
ZnF_C2H2 1198 1220 3.63e-3 SMART
ZnF_C2H2 1226 1248 6.88e-4 SMART
ZnF_C2H2 1254 1276 5.42e-2 SMART
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1510 1525 N/A INTRINSIC
ZnF_C2H2 1660 1683 7.15e-2 SMART
ZnF_C2H2 1689 1711 2.91e-2 SMART
ZnF_C2H2 1725 1747 7.26e-3 SMART
ZnF_C2H2 1753 1775 1.84e-4 SMART
ZnF_C2H2 1781 1804 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183048
SMART Domains Protein: ENSMUSP00000138179
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Zfp236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Zfp236 APN 18 82668690 missense probably benign 0.44
IGL01760:Zfp236 APN 18 82621422 missense probably damaging 1.00
IGL01923:Zfp236 APN 18 82682219 missense probably damaging 0.98
IGL01934:Zfp236 APN 18 82633120 missense probably damaging 0.99
IGL01949:Zfp236 APN 18 82624396 missense probably damaging 1.00
IGL02063:Zfp236 APN 18 82658151 missense probably benign
IGL02496:Zfp236 APN 18 82629992 missense probably damaging 1.00
IGL02513:Zfp236 APN 18 82630114 missense probably damaging 1.00
IGL02626:Zfp236 APN 18 82657995 splice site probably benign
IGL02880:Zfp236 APN 18 82624459 missense probably benign 0.15
IGL03156:Zfp236 APN 18 82680702 missense probably damaging 1.00
IGL03261:Zfp236 APN 18 82630608 missense possibly damaging 0.93
R0047:Zfp236 UTSW 18 82680692 missense probably damaging 1.00
R0052:Zfp236 UTSW 18 82639332 missense probably damaging 1.00
R0194:Zfp236 UTSW 18 82656987 missense probably damaging 1.00
R0207:Zfp236 UTSW 18 82640227 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0302:Zfp236 UTSW 18 82658088 missense probably damaging 0.99
R0730:Zfp236 UTSW 18 82640244 splice site probably benign
R0755:Zfp236 UTSW 18 82620332 missense probably damaging 1.00
R1202:Zfp236 UTSW 18 82628166 missense probably benign 0.00
R1449:Zfp236 UTSW 18 82646005 missense probably damaging 1.00
R1550:Zfp236 UTSW 18 82674424 missense possibly damaging 0.81
R1785:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R1786:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2042:Zfp236 UTSW 18 82633109 missense probably damaging 1.00
R2132:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2133:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2247:Zfp236 UTSW 18 82604298 missense possibly damaging 0.82
R2484:Zfp236 UTSW 18 82668637 missense probably benign 0.05
R3715:Zfp236 UTSW 18 82632970 splice site probably benign
R4003:Zfp236 UTSW 18 82680745 nonsense probably null
R4031:Zfp236 UTSW 18 82624465 missense probably damaging 1.00
R4482:Zfp236 UTSW 18 82644221 missense probably benign 0.04
R4492:Zfp236 UTSW 18 82630000 missense probably damaging 1.00
R4502:Zfp236 UTSW 18 82636954 missense probably benign 0.13
R4649:Zfp236 UTSW 18 82597659 missense probably damaging 1.00
R4902:Zfp236 UTSW 18 82609418 missense possibly damaging 0.89
R5064:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R5084:Zfp236 UTSW 18 82609431 missense probably damaging 1.00
R5090:Zfp236 UTSW 18 82618881 missense probably benign 0.08
R5191:Zfp236 UTSW 18 82621423 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82630094 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82658073 missense probably damaging 0.99
R5339:Zfp236 UTSW 18 82624366 missense probably damaging 0.99
R5375:Zfp236 UTSW 18 82597688 missense possibly damaging 0.93
R5445:Zfp236 UTSW 18 82682156 missense probably benign 0.02
R5513:Zfp236 UTSW 18 82658022 missense probably damaging 0.97
R5527:Zfp236 UTSW 18 82658034 missense possibly damaging 0.51
R5628:Zfp236 UTSW 18 82657122 missense probably damaging 1.00
R5758:Zfp236 UTSW 18 82671709 missense probably damaging 1.00
R5890:Zfp236 UTSW 18 82640151 missense possibly damaging 0.87
R6137:Zfp236 UTSW 18 82671794 missense possibly damaging 0.89
R6193:Zfp236 UTSW 18 82604247 missense probably damaging 1.00
R6198:Zfp236 UTSW 18 82657153 missense probably damaging 1.00
R6239:Zfp236 UTSW 18 82657104 missense possibly damaging 0.53
R6705:Zfp236 UTSW 18 82633737 missense probably damaging 0.97
R6948:Zfp236 UTSW 18 82644062 missense possibly damaging 0.94
R6989:Zfp236 UTSW 18 82628363 missense probably damaging 1.00
R7002:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R7113:Zfp236 UTSW 18 82620337 missense possibly damaging 0.82
R7261:Zfp236 UTSW 18 82609345 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGTTAGACACTGCCACAATG -3'
(R):5'- GGGTAAGATTATTTCACAGTGGC -3'

Sequencing Primer
(F):5'- GTTAGACACTGCCACAATGCTCTG -3'
(R):5'- TTCACAGTGGCTATTTTGTTATAGG -3'
Posted On2015-09-24