Incidental Mutation 'R4561:Pax2'
ID343118
Institutional Source Beutler Lab
Gene Symbol Pax2
Ensembl Gene ENSMUSG00000004231
Gene Namepaired box 2
SynonymsPax-2, Opdc
MMRRC Submission 041786-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4561 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44756045-44837871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44835963 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 374 (Y374C)
Ref Sequence ENSEMBL: ENSMUSP00000134661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000174490]
Predicted Effect unknown
Transcript: ENSMUST00000004340
AA Change: Y396C
SMART Domains Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231
AA Change: Y396C

DomainStartEndE-ValueType
PAX 15 139 4e-96 SMART
low complexity region 165 177 N/A INTRINSIC
SCOP:d1ftt__ 246 280 1e-4 SMART
Pfam:Pax2_C 300 415 1.1e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174082
Predicted Effect unknown
Transcript: ENSMUST00000174490
AA Change: Y374C
SMART Domains Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231
AA Change: Y374C

DomainStartEndE-ValueType
PAX 16 140 2.3e-96 SMART
low complexity region 166 178 N/A INTRINSIC
SCOP:d1ftt__ 224 258 8e-5 SMART
Pfam:Pax2_C 278 393 6.3e-57 PFAM
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 70,002,018 S1601P probably damaging Het
Arnt A G 3: 95,452,613 N56D probably damaging Het
Atad5 A G 11: 80,095,889 T601A probably benign Het
Calr4 A G 4: 109,246,182 N163S probably damaging Het
Cenpc1 C A 5: 86,047,632 A93S probably damaging Het
Cep135 C T 5: 76,638,193 H1048Y possibly damaging Het
Ctnna2 A G 6: 77,636,713 probably null Het
Ddx60 T C 8: 61,942,461 L144P probably damaging Het
Dera A T 6: 137,780,738 T96S possibly damaging Het
Dock9 T A 14: 121,559,007 M1853L probably benign Het
Erbb4 G A 1: 68,343,921 R306* probably null Het
Glyat G T 19: 12,651,280 L146F possibly damaging Het
Grk4 C A 5: 34,694,813 Q134K probably benign Het
Hkdc1 T C 10: 62,409,839 Q181R probably benign Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ipo4 C T 14: 55,630,089 probably benign Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcnd2 A G 6: 21,216,396 Q33R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klhl30 A T 1: 91,361,031 H504L probably damaging Het
Map4 A G 9: 110,052,371 Y101C possibly damaging Het
Mfn2 C A 4: 147,877,035 R707L probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myof T C 19: 37,922,990 N1511D probably benign Het
Neb A T 2: 52,286,155 Y1431N probably damaging Het
Nlrc5 A G 8: 94,477,146 T625A probably damaging Het
Olfr996 G T 2: 85,579,620 C127F probably damaging Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Pkhd1 A T 1: 20,534,719 L1124Q possibly damaging Het
Ppp1r3a A G 6: 14,754,682 F189L probably damaging Het
Prex2 G A 1: 11,184,545 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc22a22 T A 15: 57,263,385 Q77L probably damaging Het
Slc24a2 A T 4: 87,227,397 V140D probably damaging Het
Slc35g2 C A 9: 100,553,234 R128L probably damaging Het
Slco1b2 A G 6: 141,671,167 T409A probably benign Het
Spag7 T C 11: 70,664,990 I80M probably damaging Het
Srgap3 A G 6: 112,781,054 M164T probably damaging Het
Sspo A T 6: 48,475,534 probably null Het
Tcte2 T C 17: 13,722,602 probably benign Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tmtc4 T C 14: 122,963,298 T194A probably benign Het
Ttc21b T C 2: 66,186,218 Y1269C probably damaging Het
Zfp236 A T 18: 82,620,406 I1363N probably damaging Het
Zfp760 T A 17: 21,723,667 S608T probably benign Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Pax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Pax2 APN 19 44790688 missense probably damaging 0.99
IGL02368:Pax2 APN 19 44835409 missense possibly damaging 0.55
IGL03146:Pax2 APN 19 44833275 splice site probably benign
bradybunch UTSW 19 44790736 missense probably damaging 0.99
R0084:Pax2 UTSW 19 44818435 missense probably damaging 1.00
R0554:Pax2 UTSW 19 44761861 missense probably damaging 1.00
R1116:Pax2 UTSW 19 44757424 missense probably damaging 0.99
R1951:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1952:Pax2 UTSW 19 44788832 missense probably benign 0.09
R1981:Pax2 UTSW 19 44818465 missense probably damaging 1.00
R3015:Pax2 UTSW 19 44816024 missense probably damaging 1.00
R4320:Pax2 UTSW 19 44835399 missense probably damaging 0.97
R4562:Pax2 UTSW 19 44835963 missense unknown
R4661:Pax2 UTSW 19 44760937 missense probably damaging 1.00
R4948:Pax2 UTSW 19 44816040 missense probably damaging 1.00
R5131:Pax2 UTSW 19 44760955 missense probably damaging 0.98
R5622:Pax2 UTSW 19 44818466 missense probably damaging 1.00
R5661:Pax2 UTSW 19 44790722 missense probably damaging 1.00
R6110:Pax2 UTSW 19 44790736 missense probably damaging 0.99
R6171:Pax2 UTSW 19 44790740 missense probably damaging 1.00
R6713:Pax2 UTSW 19 44835477 missense unknown
R6791:Pax2 UTSW 19 44788821 missense possibly damaging 0.69
R7156:Pax2 UTSW 19 44788859 missense probably benign 0.00
X0018:Pax2 UTSW 19 44796676 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGATGCAGCACTACTCCTG -3'
(R):5'- GCTGATTGTGTGTCACAGAAAC -3'

Sequencing Primer
(F):5'- AGCACTACTCCTGGGCATCTG -3'
(R):5'- TGTGTCACAGAAACGGCGC -3'
Posted On2015-09-24