Incidental Mutation 'R4562:Dffb'
ID343129
Institutional Source Beutler Lab
Gene Symbol Dffb
Ensembl Gene ENSMUSG00000029027
Gene NameDNA fragmentation factor, beta subunit
Synonyms5730477D02Rik, caspase-activated DNase, Didff, CAD, CPAN, DFF40, 40kDa
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location153964449-153975126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153965456 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 317 (C317R)
Ref Sequence ENSEMBL: ENSMUSP00000030893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000058393] [ENSMUST00000105645] [ENSMUST00000133607] [ENSMUST00000141493] [ENSMUST00000147826]
PDB Structure
NMR STRUCTURE OF THE CAD DOMAIN OF CASPASE-ACTIVATED DNASE [SOLUTION NMR]
NMR STRUCTURE OF THE HETERODIMERIC COMPLEX BETWEEN CAD DOMAINS OF CAD AND ICAD [SOLUTION NMR]
CRYSTAL STRUCTURE OF CASPASE-ACTIVATED DNASE (CAD) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030893
AA Change: C317R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027
AA Change: C317R

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058393
SMART Domains Protein: ENSMUSP00000054638
Gene: ENSMUSG00000047613

DomainStartEndE-ValueType
Pfam:UPF0688 6 228 9.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133524
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Predicted Effect probably benign
Transcript: ENSMUST00000141493
Predicted Effect probably benign
Transcript: ENSMUST00000147826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219093
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal; however, mutant thymocytes and other cell types fail to undergo apoptotic DNA fragmentation in response to dexamethasone or other apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Dffb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Dffb APN 4 153965616 unclassified probably benign
R0243:Dffb UTSW 4 153965378 nonsense probably null
R0244:Dffb UTSW 4 153974615 missense probably benign 0.33
R2483:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3622:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3623:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3624:Dffb UTSW 4 153965519 missense probably damaging 1.00
R4912:Dffb UTSW 4 153965407 unclassified probably benign
R5015:Dffb UTSW 4 153972959 missense possibly damaging 0.84
R5986:Dffb UTSW 4 153965593 missense probably damaging 1.00
R6950:Dffb UTSW 4 153970092 missense probably benign
R7395:Dffb UTSW 4 153969113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACAGTGGCCAAGTTCAG -3'
(R):5'- TGGTAGACACTGCATCCACAG -3'

Sequencing Primer
(F):5'- GCCAAGTTCAGCCCTGG -3'
(R):5'- GCACTCACAGTAGAATGGTTGTCTC -3'
Posted On2015-09-24