Incidental Mutation 'R0058:Prrc2c'
ID34315
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R0058 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162698884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 253 (V253I)
Ref Sequence ENSEMBL: ENSMUSP00000138698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
Predicted Effect unknown
Transcript: ENSMUST00000028016
AA Change: V1677I
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: V1677I

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182149
AA Change: V1679I
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225
AA Change: V1679I

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182393
AA Change: V395I
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225
AA Change: V395I

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182593
AA Change: V1677I
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: V1677I

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182660
AA Change: V1679I
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: V1679I

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183223
AA Change: V253I
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225
AA Change: V253I

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGGCACTTGTGTTCATTCAATTTCCA -3'
(R):5'- GCTCACACACCTCTATGTGTTACACATC -3'

Sequencing Primer
(F):5'- GTCTGTTATAAGGACAATAGCAAGC -3'
(R):5'- acagagggaaaaacaaaacaaaac -3'
Posted On2013-05-09