Incidental Mutation 'R4562:Mslnl'
ID343169
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGCCATCAGAAGGGAGGTTTG -3'
(R):5'- CACAGGTCTGAAGCACTGAG -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On2015-09-24