Mutagenetix > Incidental Mutations

Incidental Mutation 'R4564:Mcm6'

343221

Institutional Source

Beutler Lab

Gene Symbol

Mcm6

Ensembl Gene

ENSMUSG00000026355

Gene Name

minichromosome maintenance complex component 6

Synonyms

D1Wsu22e, Mcmd6

MMRRC Submission

041789-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128331590-128359664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128343459 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 474 (H474Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027601
AA Change: H474Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: H474Q

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188755

Predicted Effect

probably damaging
Transcript: ENSMUST00000190495
AA Change: H474Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: H474Q

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191454

Meta Mutation Damage Score

0.0684

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atad3a	C	T	4: 155,747,309		probably null	Het
Bach2	T	G	4: 32,563,338	S602A	probably damaging	Het
Ccl19	G	T	4: 42,756,295	S12R	probably damaging	Het
Cfap54	T	C	10: 92,839,540		probably benign	Het
Cndp1	T	A	18: 84,622,286	I265F	probably damaging	Het
Cnot3	G	A	7: 3,653,258	R181H	probably damaging	Het
Dicer1	T	A	12: 104,704,751	K1011*	probably null	Het
Dip2b	G	A	15: 100,157,258	W99*	probably null	Het
Fam129c	T	C	8: 71,605,060		probably benign	Het
Fpr-rs6	A	T	17: 20,182,906	Y64*	probably null	Het
Fubp1	C	A	3: 152,222,936	Y480*	probably null	Het
Gfra1	T	C	19: 58,239,250		probably null	Het
Gm10770	T	C	2: 150,178,911	T229A	probably benign	Het
Gm826	A	C	2: 160,311,993		probably benign	Het
Gpd2	G	A	2: 57,307,083	V217I	possibly damaging	Het
Hectd4	T	C	5: 121,350,431	I3595T	probably benign	Het
Lmln	A	G	16: 33,109,856	E561G	probably benign	Het
Lrrc71	T	A	3: 87,745,408		probably benign	Het
Man2a2	T	A	7: 80,368,838	Y91F	probably benign	Het
Map4k4	A	G	1: 39,988,975	T319A	probably damaging	Het
Mn1	C	G	5: 111,420,667	N834K	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Npas2	A	G	1: 39,287,566	D44G	probably damaging	Het
Npc1	C	T	18: 12,191,732	G1235R	probably damaging	Het
Olfml2a	C	T	2: 38,960,294	T674I	probably benign	Het
Olfr1311	A	G	2: 112,021,767	L29P	possibly damaging	Het
Plxnb1	C	T	9: 109,113,420	A1779V	probably benign	Het
Ppil3	T	A	1: 58,431,322	D123V	probably damaging	Het
Prr23a3	A	G	9: 98,865,137	E48G	probably damaging	Het
Prr5l	T	C	2: 101,746,749	E110G	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
R3hdm1	C	T	1: 128,221,659	T839M	probably benign	Het
Rasgrf2	G	A	13: 91,885,654	Q544*	probably null	Het
Riok3	C	A	18: 12,148,879	R302S	probably damaging	Het
Rnf145	A	G	11: 44,548,808	K144E	probably benign	Het
Sin3b	A	C	8: 72,753,581	T904P	probably damaging	Het
Skint4	C	T	4: 112,119,869	T152M	probably damaging	Het
Slc22a2	A	G	17: 12,610,056	I350V	probably benign	Het
Slc6a11	G	T	6: 114,131,362	G29V	probably benign	Het
Speg	A	C	1: 75,391,834	H676P	probably damaging	Het
St6gal2	T	A	17: 55,482,647	H227Q	probably damaging	Het
Strn3	A	G	12: 51,633,621	S399P	probably benign	Het
Tbc1d1	A	G	5: 64,173,484	E2G	probably damaging	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tmem8	A	G	17: 26,117,863	R252G	possibly damaging	Het
Trpm6	T	C	19: 18,832,597	L1119P	possibly damaging	Het
Upf2	A	C	2: 6,027,312	T890P	unknown	Het
Upk1b	T	A	16: 38,780,107	K170N	probably benign	Het
Vmn1r78	A	T	7: 12,152,558	Y32F	probably damaging	Het
Vps11	A	G	9: 44,361,597	F12S	probably damaging	Het
Zfp318	T	A	17: 46,412,815	C1915S	possibly damaging	Het
Zfp346	A	C	13: 55,113,707	R103S	probably damaging	Het

Other mutations in Mcm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Mcm6	APN	1	128344383	missense	probably damaging	1.00
IGL01420:Mcm6	APN	1	128345875	missense	probably damaging	1.00
IGL01746:Mcm6	APN	1	128353524	nonsense	probably null
IGL02256:Mcm6	APN	1	128335728	critical splice donor site	probably null
IGL02624:Mcm6	APN	1	128349448	missense	possibly damaging	0.91
IGL02732:Mcm6	APN	1	128359490	missense	probably benign	0.16
IGL02750:Mcm6	APN	1	128343472	missense	probably damaging	1.00
IGL02926:Mcm6	APN	1	128339382	missense	probably damaging	1.00
IGL03189:Mcm6	APN	1	128344302	missense	probably damaging	1.00
IGL03238:Mcm6	APN	1	128355520	missense	probably benign	0.13
IGL03397:Mcm6	APN	1	128344302	missense	probably damaging	1.00
R0453:Mcm6	UTSW	1	128333555	missense	probably benign	0.00
R0501:Mcm6	UTSW	1	128355636	missense	probably benign	0.03
R0885:Mcm6	UTSW	1	128348933	missense	probably benign	0.00
R1013:Mcm6	UTSW	1	128349041	missense	probably benign
R1319:Mcm6	UTSW	1	128349052	missense	probably benign
R1396:Mcm6	UTSW	1	128351476	missense	probably damaging	1.00
R1656:Mcm6	UTSW	1	128349418	missense	possibly damaging	0.90
R1891:Mcm6	UTSW	1	128335810	missense	probably damaging	1.00
R1950:Mcm6	UTSW	1	128345989	missense	probably benign	0.35
R3411:Mcm6	UTSW	1	128351585	missense	probably benign	0.35
R4626:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4627:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4628:Mcm6	UTSW	1	128351548	missense	probably benign	0.01
R4916:Mcm6	UTSW	1	128348977	missense	probably damaging	1.00
R4965:Mcm6	UTSW	1	128359486	missense	probably damaging	1.00
R4967:Mcm6	UTSW	1	128335849	missense	probably damaging	1.00
R5016:Mcm6	UTSW	1	128343427	missense	probably damaging	1.00
R5204:Mcm6	UTSW	1	128333638	missense	probably benign	0.01
R5229:Mcm6	UTSW	1	128333584	missense	possibly damaging	0.82
R5607:Mcm6	UTSW	1	128355589	missense	probably damaging	1.00
R5811:Mcm6	UTSW	1	128335728	critical splice donor site	probably benign
R5816:Mcm6	UTSW	1	128348455	missense	probably benign	0.01
Z1088:Mcm6	UTSW	1	128344298	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAACATAGTTGTTCTAGACCC -3'
(R):5'- AAAGGTCTCTGGTAGGAAACTTTG -3'

Sequencing Primer
(F):5'- GTTGTTCTAGACCCTCAATAACAC -3'
(R):5'- GTTTACCATCTTACATCTGCAAAGC -3'

Posted On

2015-09-24