Incidental Mutation 'R4564:Olfr1311'
ID343226
Institutional Source Beutler Lab
Gene Symbol Olfr1311
Ensembl Gene ENSMUSG00000109403
Gene Nameolfactory receptor 1311
SynonymsGA_x6K02T2Q125-73069292-73068354, MOR245-21
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112019656-112024412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112021767 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 29 (L29P)
Ref Sequence ENSEMBL: ENSMUSP00000150617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208536] [ENSMUST00000213602] [ENSMUST00000215321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099601
AA Change: L29P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097196
Gene: ENSMUSG00000074948
AA Change: L29P

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.9e-43 PFAM
Pfam:7tm_1 41 287 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208536
AA Change: L29P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213602
AA Change: L29P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215321
AA Change: L29P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216319
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Olfr1311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1311 APN 2 112021132 missense probably damaging 1.00
IGL02626:Olfr1311 APN 2 112021113 missense probably damaging 1.00
R0499:Olfr1311 UTSW 2 112021432 missense probably damaging 1.00
R1511:Olfr1311 UTSW 2 112021404 missense probably benign 0.00
R3439:Olfr1311 UTSW 2 112021447 missense possibly damaging 0.95
R4756:Olfr1311 UTSW 2 112020987 missense possibly damaging 0.52
R4776:Olfr1311 UTSW 2 112020931 missense probably benign 0.01
R5777:Olfr1311 UTSW 2 112021531 missense probably damaging 1.00
R5936:Olfr1311 UTSW 2 112021587 missense probably benign 0.38
R6283:Olfr1311 UTSW 2 112021260 missense possibly damaging 0.91
R6368:Olfr1311 UTSW 2 112021551 missense probably damaging 0.99
R6484:Olfr1311 UTSW 2 112021419 nonsense probably null
X0065:Olfr1311 UTSW 2 112021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAAATGAGATGGCTTTGTG -3'
(R):5'- TGGCTCTATGCAGGAATGTG -3'

Sequencing Primer
(F):5'- CCAAATGAGATGGCTTTGTGCTTTC -3'
(R):5'- CTAACTACAGAGAAAGCTTGGTTG -3'
Posted On2015-09-24