Incidental Mutation 'R4564:Fubp1'
ID343231
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 152222936 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 480 (Y480*)
Ref Sequence ENSEMBL: ENSMUSP00000143354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196062] [ENSMUST00000196429] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000198227] [ENSMUST00000199202] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect probably null
Transcript: ENSMUST00000106121
AA Change: Y479*
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034
AA Change: Y479*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166984
AA Change: Y479*
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034
AA Change: Y479*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196062
SMART Domains Protein: ENSMUSP00000143718
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 5e-10 PDB
Predicted Effect probably null
Transcript: ENSMUST00000196429
AA Change: Y105*
SMART Domains Protein: ENSMUSP00000143478
Gene: ENSMUSG00000028034
AA Change: Y105*

DomainStartEndE-ValueType
KH 1 69 1.1e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196695
AA Change: Y480*
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034
AA Change: Y480*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196739
AA Change: Y480*
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034
AA Change: Y480*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198046
Predicted Effect probably null
Transcript: ENSMUST00000198227
AA Change: Y479*
SMART Domains Protein: ENSMUSP00000143370
Gene: ENSMUSG00000028034
AA Change: Y479*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 94 164 6.9e-20 SMART
KH 179 251 1.5e-19 SMART
KH 269 339 8.1e-19 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 7.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199199
Predicted Effect probably benign
Transcript: ENSMUST00000199202
SMART Domains Protein: ENSMUSP00000143204
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 1e-8 PDB
KH 115 185 6.9e-20 SMART
KH 200 272 1.5e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199876
AA Change: Y480*
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034
AA Change: Y480*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199918
Predicted Effect probably benign
Transcript: ENSMUST00000200056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200207
Predicted Effect probably null
Transcript: ENSMUST00000200452
AA Change: Y479*
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034
AA Change: Y479*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200524
AA Change: Y480*
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034
AA Change: Y480*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0166:Fubp1 UTSW 3 152220204 nonsense probably null
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1687:Fubp1 UTSW 3 152228201 unclassified probably benign
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R3880:Fubp1 UTSW 3 152220496 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4776:Fubp1 UTSW 3 152222068 intron probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6254:Fubp1 UTSW 3 152232408 missense possibly damaging 0.66
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGCACCAAAATTCAAAGAGGG -3'
(R):5'- GTTGCTGCCAATGTGGATAC -3'

Sequencing Primer
(F):5'- GTAGTTGGACTTTGAATTACTCAACC -3'
(R):5'- AACCTGTCACGAATGGTTGC -3'
Posted On2015-09-24