Incidental Mutation 'R4564:Tbc1d1'
ID343236
Institutional Source Beutler Lab
Gene Symbol Tbc1d1
Ensembl Gene ENSMUSG00000029174
Gene NameTBC1 domain family, member 1
SynonymsNob1, Nobq1, 1110062G02Rik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64156305-64351486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64173484 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000112493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043893] [ENSMUST00000101195] [ENSMUST00000121370] [ENSMUST00000199270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043893
AA Change: E2G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044577
Gene: ENSMUSG00000029174
AA Change: E2G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 2e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 2.5e-25 PFAM
TBC 884 1104 3.84e-89 SMART
Blast:TBC 1129 1186 5e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000101195
AA Change: E2G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098756
Gene: ENSMUSG00000029174
AA Change: E2G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000121370
AA Change: E2G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112493
Gene: ENSMUSG00000029174
AA Change: E2G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
Pfam:DUF3350 684 739 4e-29 PFAM
TBC 791 1011 3.84e-89 SMART
Blast:TBC 1036 1093 4e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129389
Predicted Effect probably benign
Transcript: ENSMUST00000147348
AA Change: E2G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119710
Gene: ENSMUSG00000029174
AA Change: E2G

DomainStartEndE-ValueType
PTB 16 164 3.29e-9 SMART
PTB 168 378 5.93e-34 SMART
low complexity region 519 540 N/A INTRINSIC
Blast:TBC 541 635 1e-27 BLAST
low complexity region 640 663 N/A INTRINSIC
Pfam:DUF3350 777 832 3.3e-29 PFAM
TBC 884 1086 2.13e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000199270
AA Change: E2G
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozgyous for a targeted mutation that removes exon 4 exhibit no adverse phenotype. Mice homozygous for a gene trap allele exhibit decreased body weight, resistance to diet-induced obesity, increased fat oxidization and decreased glucose uptake in the muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Tbc1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Tbc1d1 APN 5 64256992 missense probably damaging 1.00
IGL02341:Tbc1d1 APN 5 64275407 missense probably damaging 1.00
IGL02353:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02360:Tbc1d1 APN 5 64256836 missense probably damaging 1.00
IGL02963:Tbc1d1 APN 5 64264366 missense probably damaging 1.00
IGL03003:Tbc1d1 APN 5 64316438 missense probably damaging 1.00
R0035:Tbc1d1 UTSW 5 64256737 missense probably damaging 1.00
R0084:Tbc1d1 UTSW 5 64324454 missense probably damaging 0.96
R0321:Tbc1d1 UTSW 5 64339594 missense probably damaging 1.00
R0559:Tbc1d1 UTSW 5 64173793 missense probably damaging 1.00
R1296:Tbc1d1 UTSW 5 64264432 missense probably damaging 1.00
R1922:Tbc1d1 UTSW 5 64311221 missense probably damaging 1.00
R1928:Tbc1d1 UTSW 5 64345300 missense probably damaging 1.00
R2095:Tbc1d1 UTSW 5 64316501 missense probably benign 0.01
R2107:Tbc1d1 UTSW 5 64284705 missense probably benign 0.19
R2253:Tbc1d1 UTSW 5 64284800 missense probably benign 0.00
R3545:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3546:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R3547:Tbc1d1 UTSW 5 64286007 missense probably damaging 1.00
R4039:Tbc1d1 UTSW 5 64316428 missense probably damaging 0.99
R4289:Tbc1d1 UTSW 5 64260428 missense probably damaging 1.00
R4380:Tbc1d1 UTSW 5 64333548 missense probably benign 0.29
R4405:Tbc1d1 UTSW 5 64173670 missense possibly damaging 0.93
R4722:Tbc1d1 UTSW 5 64263557 missense probably damaging 1.00
R4779:Tbc1d1 UTSW 5 64278046 critical splice donor site probably null
R5256:Tbc1d1 UTSW 5 64282009 missense probably damaging 1.00
R5268:Tbc1d1 UTSW 5 64324567 missense probably damaging 0.99
R5510:Tbc1d1 UTSW 5 64333395 missense probably damaging 1.00
R5547:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5620:Tbc1d1 UTSW 5 64173712 missense probably benign 0.44
R5680:Tbc1d1 UTSW 5 64324544 missense possibly damaging 0.73
R5874:Tbc1d1 UTSW 5 64349930 makesense probably null
R6002:Tbc1d1 UTSW 5 64333433 missense probably damaging 1.00
R6058:Tbc1d1 UTSW 5 64278009 missense probably damaging 1.00
R6092:Tbc1d1 UTSW 5 64349899 missense probably benign 0.00
R6118:Tbc1d1 UTSW 5 64284037 missense probably damaging 0.98
R6183:Tbc1d1 UTSW 5 64275425 missense probably damaging 1.00
R6447:Tbc1d1 UTSW 5 64333493 missense probably damaging 1.00
R6824:Tbc1d1 UTSW 5 64256902 missense probably benign 0.02
R6913:Tbc1d1 UTSW 5 64311109 missense probably benign 0.26
X0064:Tbc1d1 UTSW 5 64275452 missense probably benign 0.04
Z1088:Tbc1d1 UTSW 5 64275393 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCCTATGGTTCGGTTTCAGACTG -3'
(R):5'- AAACCCAAAGGCGGACTTGC -3'

Sequencing Primer
(F):5'- GTTAAATTCTGGAATAACAACGCTGC -3'
(R):5'- CCAAAGGCGGACTTGCTTTGTC -3'
Posted On2015-09-24