Incidental Mutation 'R4564:Cnot3'
ID343239
Institutional Source Beutler Lab
Gene Symbol Cnot3
Ensembl Gene ENSMUSG00000035632
Gene NameCCR4-NOT transcription complex, subunit 3
SynonymsA930039N10Rik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3645268-3661109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3653258 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000039098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038913] [ENSMUST00000206287]
Predicted Effect probably damaging
Transcript: ENSMUST00000038913
AA Change: R181H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632
AA Change: R181H

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129973
Predicted Effect unknown
Transcript: ENSMUST00000132344
AA Change: R137H
SMART Domains Protein: ENSMUSP00000117297
Gene: ENSMUSG00000035632
AA Change: R137H

DomainStartEndE-ValueType
Pfam:Not3 1 189 8.9e-77 PFAM
low complexity region 214 231 N/A INTRINSIC
SCOP:d1cpo_2 260 335 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135977
SMART Domains Protein: ENSMUSP00000118822
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 78 1.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175549
Predicted Effect probably benign
Transcript: ENSMUST00000206287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206331
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show defective outgrowth of the inner cell mass and complete embryonic lethality at implantation. Heterozygotes exhibit decreased cardiac muscle contractility and develop severe cardiomyopathy leading to heart failure in response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Cnot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cnot3 APN 7 3650855 missense probably damaging 1.00
IGL02231:Cnot3 APN 7 3658210 missense probably benign 0.00
IGL02476:Cnot3 APN 7 3658068 missense probably benign 0.01
IGL03102:Cnot3 APN 7 3656156 nonsense probably null
IGL03181:Cnot3 APN 7 3653248 missense probably damaging 1.00
R4531:Cnot3 UTSW 7 3658074 missense probably benign
R5071:Cnot3 UTSW 7 3650861 missense probably damaging 1.00
R5649:Cnot3 UTSW 7 3658083 missense probably benign 0.08
R5869:Cnot3 UTSW 7 3644930 unclassified probably benign
R6120:Cnot3 UTSW 7 3645336 unclassified probably null
R6759:Cnot3 UTSW 7 3651919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACTGGCCCATGTTAGGAG -3'
(R):5'- TCACCCTCTGTGCCATGAAG -3'

Sequencing Primer
(F):5'- CCCATGTTAGGAGGGCTGGAG -3'
(R):5'- TCTGTGCCATGAAGGTCAGC -3'
Posted On2015-09-24