Incidental Mutation 'R4564:Rnf145'
ID343250
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44548808 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 144 (K144E)
Ref Sequence ENSEMBL: ENSMUSP00000019333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333] [ENSMUST00000101327]
Predicted Effect probably benign
Transcript: ENSMUST00000019333
AA Change: K144E

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: K144E

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101327
AA Change: K144E

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098881
Gene: ENSMUSG00000019189
AA Change: K144E

DomainStartEndE-ValueType
Pfam:TRC8_N 7 266 1.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124959
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0598:Rnf145 UTSW 11 44548943 missense probably damaging 1.00
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R0837:Rnf145 UTSW 11 44524988 missense probably benign 0.00
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R3855:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R6963:Rnf145 UTSW 11 44564277 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCTGAATCAGCCTTTGGGAG -3'
(R):5'- TCCCGGTATGCAGACTTAGC -3'

Sequencing Primer
(F):5'- TAACATAGGTCCTCAGGCTTGAC -3'
(R):5'- TGCAGACTTAGCGAGGTTATAC -3'
Posted On2015-09-24