Mutagenetix > Incidental Mutations

Incidental Mutation 'R4564:Dicer1'

343254

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

041789-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 104704751 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1011 (K1011*)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

Predicted Effect

probably null
Transcript: ENSMUST00000041987
AA Change: K1011*

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: K1011*

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.574

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

97% (58/60)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atad3a	C	T	4: 155,747,309		probably null	Het
Bach2	T	G	4: 32,563,338	S602A	probably damaging	Het
Ccl19	G	T	4: 42,756,295	S12R	probably damaging	Het
Cfap54	T	C	10: 92,839,540		probably benign	Het
Cndp1	T	A	18: 84,622,286	I265F	probably damaging	Het
Cnot3	G	A	7: 3,653,258	R181H	probably damaging	Het
Dip2b	G	A	15: 100,157,258	W99*	probably null	Het
Fam129c	T	C	8: 71,605,060		probably benign	Het
Fpr-rs6	A	T	17: 20,182,906	Y64*	probably null	Het
Fubp1	C	A	3: 152,222,936	Y480*	probably null	Het
Gfra1	T	C	19: 58,239,250		probably null	Het
Gm10770	T	C	2: 150,178,911	T229A	probably benign	Het
Gm826	A	C	2: 160,311,993		probably benign	Het
Gpd2	G	A	2: 57,307,083	V217I	possibly damaging	Het
Hectd4	T	C	5: 121,350,431	I3595T	probably benign	Het
Lmln	A	G	16: 33,109,856	E561G	probably benign	Het
Lrrc71	T	A	3: 87,745,408		probably benign	Het
Man2a2	T	A	7: 80,368,838	Y91F	probably benign	Het
Map4k4	A	G	1: 39,988,975	T319A	probably damaging	Het
Mcm6	G	T	1: 128,343,459	H474Q	probably damaging	Het
Mn1	C	G	5: 111,420,667	N834K	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Npas2	A	G	1: 39,287,566	D44G	probably damaging	Het
Npc1	C	T	18: 12,191,732	G1235R	probably damaging	Het
Olfml2a	C	T	2: 38,960,294	T674I	probably benign	Het
Olfr1311	A	G	2: 112,021,767	L29P	possibly damaging	Het
Plxnb1	C	T	9: 109,113,420	A1779V	probably benign	Het
Ppil3	T	A	1: 58,431,322	D123V	probably damaging	Het
Prr23a3	A	G	9: 98,865,137	E48G	probably damaging	Het
Prr5l	T	C	2: 101,746,749	E110G	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
R3hdm1	C	T	1: 128,221,659	T839M	probably benign	Het
Rasgrf2	G	A	13: 91,885,654	Q544*	probably null	Het
Riok3	C	A	18: 12,148,879	R302S	probably damaging	Het
Rnf145	A	G	11: 44,548,808	K144E	probably benign	Het
Sin3b	A	C	8: 72,753,581	T904P	probably damaging	Het
Skint4	C	T	4: 112,119,869	T152M	probably damaging	Het
Slc22a2	A	G	17: 12,610,056	I350V	probably benign	Het
Slc6a11	G	T	6: 114,131,362	G29V	probably benign	Het
Speg	A	C	1: 75,391,834	H676P	probably damaging	Het
St6gal2	T	A	17: 55,482,647	H227Q	probably damaging	Het
Strn3	A	G	12: 51,633,621	S399P	probably benign	Het
Tbc1d1	A	G	5: 64,173,484	E2G	probably damaging	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tmem8	A	G	17: 26,117,863	R252G	possibly damaging	Het
Trpm6	T	C	19: 18,832,597	L1119P	possibly damaging	Het
Upf2	A	C	2: 6,027,312	T890P	unknown	Het
Upk1b	T	A	16: 38,780,107	K170N	probably benign	Het
Vmn1r78	A	T	7: 12,152,558	Y32F	probably damaging	Het
Vps11	A	G	9: 44,361,597	F12S	probably damaging	Het
Zfp318	T	A	17: 46,412,815	C1915S	possibly damaging	Het
Zfp346	A	C	13: 55,113,707	R103S	probably damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCGACCTTCCTAAACTCAC -3'
(R):5'- CTTAGGGAATGTGTAGGCATACC -3'

Sequencing Primer
(F):5'- ACTCACAGGTCATTGCTATACTG -3'
(R):5'- CCTAAGTTGGAGTTCTAACCACTGG -3'

Posted On

2015-09-24