Incidental Mutation 'R4564:Slc22a2'
ID343262
Institutional Source Beutler Lab
Gene Symbol Slc22a2
Ensembl Gene ENSMUSG00000040966
Gene Namesolute carrier family 22 (organic cation transporter), member 2
SynonymsOrct2, Oct2
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12584189-12628465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12610056 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 350 (I350V)
Ref Sequence ENSEMBL: ENSMUSP00000041186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046959]
Predicted Effect probably benign
Transcript: ENSMUST00000046959
AA Change: I350V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: I350V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 80 528 7.6e-37 PFAM
Pfam:MFS_1 134 398 3.5e-21 PFAM
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gfra1 T C 19: 58,239,250 probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Slc22a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc22a2 APN 17 12608418 missense possibly damaging 0.79
IGL00658:Slc22a2 APN 17 12615315 missense probably benign 0.37
IGL01073:Slc22a2 APN 17 12584349 missense probably benign 0.00
IGL01573:Slc22a2 APN 17 12605961 missense probably damaging 0.99
IGL02000:Slc22a2 APN 17 12584383 missense possibly damaging 0.77
IGL02943:Slc22a2 APN 17 12610061 missense probably damaging 1.00
IGL03301:Slc22a2 APN 17 12606039 missense probably damaging 1.00
R0492:Slc22a2 UTSW 17 12615272 missense probably benign 0.00
R0835:Slc22a2 UTSW 17 12612431 missense probably benign 0.01
R1330:Slc22a2 UTSW 17 12586812 missense possibly damaging 0.94
R1432:Slc22a2 UTSW 17 12584308 missense possibly damaging 0.89
R1559:Slc22a2 UTSW 17 12584411 missense probably damaging 1.00
R1855:Slc22a2 UTSW 17 12586812 missense probably damaging 0.99
R1884:Slc22a2 UTSW 17 12614826 splice site probably benign
R2042:Slc22a2 UTSW 17 12599125 missense probably benign 0.01
R2197:Slc22a2 UTSW 17 12599062 missense probably damaging 1.00
R2255:Slc22a2 UTSW 17 12599175 missense probably damaging 1.00
R2271:Slc22a2 UTSW 17 12586805 missense probably benign
R4003:Slc22a2 UTSW 17 12612450 missense probably benign 0.01
R4021:Slc22a2 UTSW 17 12584489 missense probably damaging 1.00
R4093:Slc22a2 UTSW 17 12612394 missense probably damaging 1.00
R4404:Slc22a2 UTSW 17 12614764 missense probably damaging 1.00
R4419:Slc22a2 UTSW 17 12612586 nonsense probably null
R4866:Slc22a2 UTSW 17 12584429 missense probably damaging 1.00
R4877:Slc22a2 UTSW 17 12614815 missense possibly damaging 0.53
R5224:Slc22a2 UTSW 17 12586832 missense probably damaging 0.97
R5668:Slc22a2 UTSW 17 12608409 missense probably benign
R6326:Slc22a2 UTSW 17 12612410 nonsense probably null
Z1088:Slc22a2 UTSW 17 12614776 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAGGCCCTCTTTTGTACAATGGAG -3'
(R):5'- TATCAGGTGGAGCTGCTGTC -3'

Sequencing Primer
(F):5'- AGGACTGAACCCCTGATGG -3'
(R):5'- CCGTGAGCTATGCGTCAACATC -3'
Posted On2015-09-24