Incidental Mutation 'R4565:Jph1'
ID 343276
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Name junctophilin 1
Synonyms JP-1, ENSMUSG00000054314, mitsugumin72
MMRRC Submission 041790-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.701) question?
Stock # R4565 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 17034784-17168113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17074426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 531 (Y531H)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
AlphaFold Q9ET80
Predicted Effect possibly damaging
Transcript: ENSMUST00000038382
AA Change: Y531H

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: Y531H

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186024
AA Change: Y6H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,375,806 (GRCm39) probably benign Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Afg3l1 A T 8: 124,228,608 (GRCm39) K725* probably null Het
Alkbh1 T C 12: 87,478,236 (GRCm39) D225G probably damaging Het
Anxa2 A T 9: 69,397,019 (GRCm39) K241M probably damaging Het
Bptf G A 11: 106,963,836 (GRCm39) T1786M probably damaging Het
Cnst A G 1: 179,432,114 (GRCm39) E208G probably damaging Het
Dcdc2b T C 4: 129,504,778 (GRCm39) T118A probably benign Het
Dhx35 C A 2: 158,691,455 (GRCm39) A646E probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dnhd1 T A 7: 105,301,163 (GRCm39) D173E possibly damaging Het
Dpy19l1 A T 9: 24,343,684 (GRCm39) L487Q probably null Het
Gtse1 T G 15: 85,759,385 (GRCm39) V631G probably damaging Het
Haspin G A 11: 73,028,445 (GRCm39) L215F probably benign Het
Herc2 T C 7: 55,803,586 (GRCm39) V2207A possibly damaging Het
Limk2 A G 11: 3,298,634 (GRCm39) I261T probably damaging Het
Oas3 A G 5: 120,909,104 (GRCm39) F281L probably damaging Het
Or2a25 A T 6: 42,888,472 (GRCm39) Q5L probably benign Het
Or7a40 C A 16: 16,491,557 (GRCm39) G96V probably damaging Het
Pcdhb17 A G 18: 37,619,523 (GRCm39) T438A probably benign Het
Pfdn5 T C 15: 102,235,220 (GRCm39) probably benign Het
Rab11fip3 A G 17: 26,287,680 (GRCm39) C158R possibly damaging Het
Rbmxl1 G A 8: 79,232,639 (GRCm39) P235S probably benign Het
Slc9b1 G T 3: 135,088,478 (GRCm39) V280F probably damaging Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Trpm3 T C 19: 22,965,233 (GRCm39) I1576T probably benign Het
Trpm6 T A 19: 18,803,236 (GRCm39) V893D probably damaging Het
Ttc13 A T 8: 125,408,826 (GRCm39) N583K probably damaging Het
Zfp618 T C 4: 63,039,588 (GRCm39) C396R probably damaging Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17,161,964 (GRCm39) missense probably damaging 1.00
IGL01382:Jph1 APN 1 17,086,380 (GRCm39) missense probably damaging 1.00
IGL01936:Jph1 APN 1 17,167,608 (GRCm39) missense probably damaging 0.98
IGL02012:Jph1 APN 1 17,167,638 (GRCm39) missense probably benign 0.00
IGL02142:Jph1 APN 1 17,161,884 (GRCm39) missense probably damaging 0.99
IGL02212:Jph1 APN 1 17,161,981 (GRCm39) missense probably damaging 1.00
IGL02317:Jph1 APN 1 17,074,147 (GRCm39) missense probably benign
IGL02450:Jph1 APN 1 17,074,201 (GRCm39) missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17,074,675 (GRCm39) missense probably benign
R0668:Jph1 UTSW 1 17,161,895 (GRCm39) missense probably damaging 1.00
R0893:Jph1 UTSW 1 17,074,507 (GRCm39) nonsense probably null
R1308:Jph1 UTSW 1 17,161,918 (GRCm39) missense probably damaging 1.00
R1318:Jph1 UTSW 1 17,067,714 (GRCm39) missense probably damaging 1.00
R1495:Jph1 UTSW 1 17,161,876 (GRCm39) missense probably benign
R1712:Jph1 UTSW 1 17,167,456 (GRCm39) missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17,162,279 (GRCm39) missense probably damaging 1.00
R4492:Jph1 UTSW 1 17,067,770 (GRCm39) missense probably damaging 1.00
R4559:Jph1 UTSW 1 17,074,735 (GRCm39) missense probably benign
R4694:Jph1 UTSW 1 17,067,729 (GRCm39) missense probably damaging 0.98
R4700:Jph1 UTSW 1 17,161,928 (GRCm39) missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17,161,835 (GRCm39) missense probably damaging 1.00
R5029:Jph1 UTSW 1 17,161,615 (GRCm39) missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17,161,622 (GRCm39) missense probably benign 0.38
R5316:Jph1 UTSW 1 17,161,750 (GRCm39) missense probably damaging 1.00
R5691:Jph1 UTSW 1 17,074,587 (GRCm39) missense probably benign 0.21
R6209:Jph1 UTSW 1 17,167,810 (GRCm39) missense probably damaging 0.98
R6380:Jph1 UTSW 1 17,162,071 (GRCm39) missense probably damaging 1.00
R6645:Jph1 UTSW 1 17,161,985 (GRCm39) missense probably damaging 1.00
R6829:Jph1 UTSW 1 17,074,647 (GRCm39) missense probably damaging 1.00
R7007:Jph1 UTSW 1 17,074,410 (GRCm39) missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17,162,266 (GRCm39) missense probably damaging 1.00
R7689:Jph1 UTSW 1 17,074,192 (GRCm39) nonsense probably null
R7719:Jph1 UTSW 1 17,162,215 (GRCm39) missense probably damaging 1.00
R7792:Jph1 UTSW 1 17,074,602 (GRCm39) missense probably benign 0.02
R8132:Jph1 UTSW 1 17,086,379 (GRCm39) missense probably damaging 1.00
R8871:Jph1 UTSW 1 17,067,719 (GRCm39) missense possibly damaging 0.83
R9217:Jph1 UTSW 1 17,167,632 (GRCm39) missense probably benign 0.24
R9272:Jph1 UTSW 1 17,161,838 (GRCm39) missense probably damaging 1.00
R9631:Jph1 UTSW 1 17,161,607 (GRCm39) missense probably damaging 0.99
Z1176:Jph1 UTSW 1 17,167,576 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCAACTGGTTTTGTCACAG -3'
(R):5'- TGAGTCAAGTCCCAAACAGAG -3'

Sequencing Primer
(F):5'- GCAACTGGTTTTGTCACAGATTTAG -3'
(R):5'- AGAGCCACTCTCCCCAG -3'
Posted On 2015-09-24