Incidental Mutation 'R4565:Afg3l1'
ID343289
Institutional Source Beutler Lab
Gene Symbol Afg3l1
Ensembl Gene ENSMUSG00000031967
Gene NameAFG3-like AAA ATPase 1
Synonyms3110061K15Rik, 1700047G05Rik
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123477903-123503916 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123501869 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 725 (K725*)
Ref Sequence ENSEMBL: ENSMUSP00000001520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001520] [ENSMUST00000098320] [ENSMUST00000127664] [ENSMUST00000176155] [ENSMUST00000176286] [ENSMUST00000177240]
Predicted Effect probably null
Transcript: ENSMUST00000001520
AA Change: K725*
SMART Domains Protein: ENSMUSP00000001520
Gene: ENSMUSG00000031967
AA Change: K725*

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 1.2e-8 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Pfam:Peptidase_M41 533 736 6.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098320
SMART Domains Protein: ENSMUSP00000095924
Gene: ENSMUSG00000031967

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 6.5e-9 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152469
Predicted Effect probably benign
Transcript: ENSMUST00000176155
SMART Domains Protein: ENSMUSP00000135524
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 189 3.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176286
SMART Domains Protein: ENSMUSP00000134757
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 96 3.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177240
SMART Domains Protein: ENSMUSP00000135216
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 101 4.5e-10 PFAM
Pfam:Dysbindin 96 142 2.7e-14 PFAM
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable myelination defects or axonal degeneration in the brain and spinal cord and normal mitochondria in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Afg3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Afg3l1 APN 8 123487389 missense probably benign 0.01
IGL01547:Afg3l1 APN 8 123501351 missense probably benign 0.17
IGL01612:Afg3l1 APN 8 123494853 missense probably benign 0.01
IGL01616:Afg3l1 APN 8 123502007 missense probably damaging 1.00
IGL01969:Afg3l1 APN 8 123480431 missense probably damaging 1.00
IGL01996:Afg3l1 APN 8 123501894 missense probably damaging 0.99
IGL02591:Afg3l1 APN 8 123486009 missense probably damaging 1.00
R0370:Afg3l1 UTSW 8 123501554 missense probably damaging 1.00
R1775:Afg3l1 UTSW 8 123492900 missense possibly damaging 0.89
R1817:Afg3l1 UTSW 8 123501931 missense probably damaging 0.99
R2152:Afg3l1 UTSW 8 123494836 missense probably damaging 1.00
R2516:Afg3l1 UTSW 8 123501954 missense probably damaging 0.99
R2844:Afg3l1 UTSW 8 123494939 intron probably benign
R3013:Afg3l1 UTSW 8 123484677 missense probably benign 0.27
R3732:Afg3l1 UTSW 8 123501233 missense probably damaging 1.00
R4603:Afg3l1 UTSW 8 123501935 missense probably benign 0.43
R4888:Afg3l1 UTSW 8 123488326 critical splice donor site probably null
R4932:Afg3l1 UTSW 8 123501380 missense probably damaging 1.00
R4970:Afg3l1 UTSW 8 123498653 missense probably benign 0.04
R5027:Afg3l1 UTSW 8 123489814 missense probably benign 0.00
R5133:Afg3l1 UTSW 8 123489793 missense probably benign 0.16
R5457:Afg3l1 UTSW 8 123489968 missense possibly damaging 0.88
R5911:Afg3l1 UTSW 8 123500039 missense possibly damaging 0.79
R6268:Afg3l1 UTSW 8 123492926 missense probably damaging 1.00
R7116:Afg3l1 UTSW 8 123489862 missense probably damaging 0.98
R7303:Afg3l1 UTSW 8 123501269 missense probably damaging 1.00
Z1088:Afg3l1 UTSW 8 123488242 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TATAATCGGACCCTGGAGCTG -3'
(R):5'- TCAGCAGTGGTCATAAGCC -3'

Sequencing Primer
(F):5'- TGGAGCTGCTCACACAGTG -3'
(R):5'- ACAGGCTACACAGGGCTCTC -3'
Posted On2015-09-24