Incidental Mutation 'R4579:Ugt1a10'
ID343462
Institutional Source Beutler Lab
Gene Symbol Ugt1a10
Ensembl Gene ENSMUSG00000090165
Gene NameUDP glycosyltransferase 1 family, polypeptide A10
SynonymsA13
MMRRC Submission 041801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4579 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location88055388-88219004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88056116 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 212 (M212T)
Ref Sequence ENSEMBL: ENSMUSP00000108767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000113142
AA Change: M212T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: M212T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (88/91)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930004D18Rik A G 2: 18,027,037 I90T probably damaging Het
Acox3 A G 5: 35,604,643 N444D probably damaging Het
Adamts16 A G 13: 70,779,624 Y499H probably damaging Het
Ank2 A T 3: 126,958,963 V368D probably damaging Het
Atad5 T C 11: 80,095,191 V368A probably damaging Het
Atp13a5 T C 16: 29,248,338 probably null Het
Bdh1 A T 16: 31,436,136 probably benign Het
Bmp6 A T 13: 38,469,725 Y256F probably damaging Het
Bub1b C A 2: 118,623,176 S496* probably null Het
Capn15 C T 17: 25,959,837 R1128H probably damaging Het
Ccnf T A 17: 24,231,329 R461* probably null Het
Col6a1 C T 10: 76,711,357 V725I unknown Het
Cp T C 3: 19,957,435 probably null Het
Cul2 T C 18: 3,430,957 V577A probably benign Het
Cux2 A T 5: 121,860,653 I1408K probably benign Het
Cyp2c69 T A 19: 39,881,186 T130S possibly damaging Het
Cyp3a57 A G 5: 145,374,264 T278A probably benign Het
Dchs1 T G 7: 105,754,765 T2857P probably damaging Het
Dchs1 A G 7: 105,758,973 M1884T probably benign Het
Dnah3 T C 7: 120,009,331 S1802G probably damaging Het
Dner T C 1: 84,383,816 S691G probably damaging Het
Dzip1l A T 9: 99,647,214 Q332L probably damaging Het
Eprs A G 1: 185,401,607 Y827C probably damaging Het
Ermp1 A T 19: 29,616,651 N706K probably damaging Het
F830045P16Rik A G 2: 129,463,503 L317S probably damaging Het
Fam120c G T X: 151,436,183 G696W probably damaging Het
Fance T A 17: 28,317,151 probably null Het
Fancl G T 11: 26,468,423 probably null Het
Fbxo30 T A 10: 11,289,549 V5E probably benign Het
Foxn4 A T 5: 114,256,825 I347N possibly damaging Het
Galr2 A T 11: 116,281,499 D5V probably benign Het
Gm14139 T A 2: 150,192,223 Y186N probably damaging Het
Gm4845 T G 1: 141,257,127 noncoding transcript Het
Gm8909 C T 17: 36,161,757 probably benign Het
Gm996 T A 2: 25,579,649 R83S possibly damaging Het
Gnao1 A T 8: 93,966,904 Q73L probably damaging Het
Gnpat T A 8: 124,878,502 probably null Het
Hectd1 A G 12: 51,744,573 M2594T probably damaging Het
Hint3 T C 10: 30,610,432 H117R probably damaging Het
Hsd3b6 A G 3: 98,806,225 F253L probably damaging Het
Itgal A G 7: 127,305,294 D313G possibly damaging Het
Kbtbd2 A T 6: 56,778,908 D614E probably damaging Het
Ksr2 A T 5: 117,756,270 I825F probably damaging Het
L3mbtl4 A T 17: 68,764,640 S521C probably benign Het
Lamc1 T C 1: 153,247,269 N725S probably damaging Het
Med1 T G 11: 98,158,422 E516A possibly damaging Het
Mical3 A T 6: 120,958,699 V1622E probably benign Het
Miip G A 4: 147,861,061 P373S probably damaging Het
Myo7a C A 7: 98,073,193 S1175I probably damaging Het
Ndst3 A T 3: 123,546,825 D781E probably benign Het
Nf1 T A 11: 79,468,757 V1407E probably damaging Het
Olfr1066 T C 2: 86,455,515 Y252C probably damaging Het
Olfr1216 T C 2: 89,013,144 I307V probably benign Het
Olfr133 G C 17: 38,149,405 K272N probably damaging Het
Olfr282 A T 15: 98,437,679 D70V probably damaging Het
Olfr452 A T 6: 42,790,524 I162F probably benign Het
Olfr870 G T 9: 20,171,114 S152R probably damaging Het
Opalin A G 19: 41,067,757 L33P probably damaging Het
Pcdhb2 T A 18: 37,296,115 N23K probably damaging Het
Pdap1 A G 5: 145,136,881 probably benign Het
Pds5b A G 5: 150,746,732 E395G probably damaging Het
Pex1 C A 5: 3,618,880 R624S probably benign Het
Pitrm1 G A 13: 6,558,225 V329I probably benign Het
Pop1 G A 15: 34,515,824 probably benign Het
Prkaa1 A G 15: 5,160,601 probably null Het
Slc38a6 G T 12: 73,288,524 probably null Het
Slc5a9 T A 4: 111,893,187 Y158F probably damaging Het
Spata3 T A 1: 86,026,453 V114E probably damaging Het
Tbcb T A 7: 30,231,594 I34F possibly damaging Het
Tek T A 4: 94,863,666 Y1014* probably null Het
Togaram1 G T 12: 64,967,907 C644F probably damaging Het
Trim56 A C 5: 137,114,064 D199E possibly damaging Het
Tssk3 A T 4: 129,489,317 D187E probably benign Het
Ttn G A 2: 76,896,803 probably benign Het
Twf2 G A 9: 106,212,826 R126Q probably benign Het
Vmn1r177 A T 7: 23,866,347 F35I possibly damaging Het
Vmn1r44 T A 6: 89,893,933 H77Q possibly damaging Het
Zfp524 G A 7: 5,018,348 V292I probably benign Het
Zfp788 T G 7: 41,647,594 I56S probably benign Het
Other mutations in Ugt1a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Ugt1a10 APN 1 88055987 missense possibly damaging 0.72
IGL02219:Ugt1a10 APN 1 88056058 missense probably benign 0.00
IGL02511:Ugt1a10 APN 1 88055863 missense probably damaging 1.00
IGL02990:Ugt1a10 APN 1 88055879 missense probably damaging 1.00
PIT4142001:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R0201:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0201:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0522:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0525:Ugt1a10 UTSW 1 88218249 missense probably damaging 1.00
R0554:Ugt1a10 UTSW 1 88056095 missense probably damaging 1.00
R0748:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R0811:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R0812:Ugt1a10 UTSW 1 88056182 missense probably benign 0.33
R1129:Ugt1a10 UTSW 1 88055609 missense probably benign
R1207:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1432:Ugt1a10 UTSW 1 88216260 missense probably damaging 1.00
R1457:Ugt1a10 UTSW 1 88055711 missense probably damaging 1.00
R1469:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R1972:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R1973:Ugt1a10 UTSW 1 88056047 missense probably damaging 1.00
R2039:Ugt1a10 UTSW 1 88055981 missense probably benign 0.32
R2307:Ugt1a10 UTSW 1 88055947 missense probably benign 0.01
R3952:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R3973:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R4232:Ugt1a10 UTSW 1 88056210 missense probably benign 0.39
R4392:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4393:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4402:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4417:Ugt1a10 UTSW 1 88055995 missense probably benign
R4474:Ugt1a10 UTSW 1 88215928 intron probably benign
R4476:Ugt1a10 UTSW 1 88215928 intron probably benign
R4515:Ugt1a10 UTSW 1 88056197 missense probably damaging 1.00
R4582:Ugt1a10 UTSW 1 88055741 missense possibly damaging 0.90
R4609:Ugt1a10 UTSW 1 88055482 start codon destroyed possibly damaging 0.92
R4627:Ugt1a10 UTSW 1 88218390 missense probably damaging 1.00
R4790:Ugt1a10 UTSW 1 88056287 missense probably damaging 0.98
R4799:Ugt1a10 UTSW 1 88215928 intron probably benign
R4910:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
R4915:Ugt1a10 UTSW 1 88055924 missense probably damaging 1.00
R5110:Ugt1a10 UTSW 1 88056252 splice site probably null
R5168:Ugt1a10 UTSW 1 88055809 missense probably benign 0.01
R5329:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
R5373:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5374:Ugt1a10 UTSW 1 88055910 missense probably damaging 0.98
R5615:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6498:Ugt1a10 UTSW 1 88216140 missense probably damaging 1.00
R6646:Ugt1a10 UTSW 1 88216158 small deletion probably benign
R6727:Ugt1a10 UTSW 1 88056257 splice site probably null
R6809:Ugt1a10 UTSW 1 88055925 missense probably damaging 0.98
R6924:Ugt1a10 UTSW 1 88055657 missense probably damaging 0.99
R6967:Ugt1a10 UTSW 1 88215123 missense probably damaging 1.00
S24628:Ugt1a10 UTSW 1 88216158 small deletion probably benign
X0013:Ugt1a10 UTSW 1 88216254 missense probably damaging 1.00
Z1088:Ugt1a10 UTSW 1 88055842 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CTTGAAGCAGAGATCTTTTGATGCAG -3'
(R):5'- CATGTTGGGCATCACAGGTC -3'

Sequencing Primer
(F):5'- CAGAGATCTTTTGATGCAGTGTTTC -3'
(R):5'- ATCACAGGTCTGGGGAACTC -3'
Posted On2015-09-24