Incidental Mutation 'R4579:Nf1'
ID343520
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 041801-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4579 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79468757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1407 (V1407E)
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251]
Predicted Effect probably damaging
Transcript: ENSMUST00000071325
AA Change: V1407E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: V1407E

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108251
AA Change: V1386E

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: V1386E

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130979
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930004D18Rik A G 2: 18,027,037 I90T probably damaging Het
Acox3 A G 5: 35,604,643 N444D probably damaging Het
Adamts16 A G 13: 70,779,624 Y499H probably damaging Het
Ank2 A T 3: 126,958,963 V368D probably damaging Het
Atad5 T C 11: 80,095,191 V368A probably damaging Het
Atp13a5 T C 16: 29,248,338 probably null Het
Bdh1 A T 16: 31,436,136 probably benign Het
Bmp6 A T 13: 38,469,725 Y256F probably damaging Het
Bub1b C A 2: 118,623,176 S496* probably null Het
Capn15 C T 17: 25,959,837 R1128H probably damaging Het
Ccnf T A 17: 24,231,329 R461* probably null Het
Col6a1 C T 10: 76,711,357 V725I unknown Het
Cp T C 3: 19,957,435 probably null Het
Cul2 T C 18: 3,430,957 V577A probably benign Het
Cux2 A T 5: 121,860,653 I1408K probably benign Het
Cyp2c69 T A 19: 39,881,186 T130S possibly damaging Het
Cyp3a57 A G 5: 145,374,264 T278A probably benign Het
Dchs1 T G 7: 105,754,765 T2857P probably damaging Het
Dchs1 A G 7: 105,758,973 M1884T probably benign Het
Dnah3 T C 7: 120,009,331 S1802G probably damaging Het
Dner T C 1: 84,383,816 S691G probably damaging Het
Dzip1l A T 9: 99,647,214 Q332L probably damaging Het
Eprs A G 1: 185,401,607 Y827C probably damaging Het
Ermp1 A T 19: 29,616,651 N706K probably damaging Het
F830045P16Rik A G 2: 129,463,503 L317S probably damaging Het
Fam120c G T X: 151,436,183 G696W probably damaging Het
Fance T A 17: 28,317,151 probably null Het
Fancl G T 11: 26,468,423 probably null Het
Fbxo30 T A 10: 11,289,549 V5E probably benign Het
Foxn4 A T 5: 114,256,825 I347N possibly damaging Het
Galr2 A T 11: 116,281,499 D5V probably benign Het
Gm14139 T A 2: 150,192,223 Y186N probably damaging Het
Gm4845 T G 1: 141,257,127 noncoding transcript Het
Gm8909 C T 17: 36,161,757 probably benign Het
Gm996 T A 2: 25,579,649 R83S possibly damaging Het
Gnao1 A T 8: 93,966,904 Q73L probably damaging Het
Gnpat T A 8: 124,878,502 probably null Het
Hectd1 A G 12: 51,744,573 M2594T probably damaging Het
Hint3 T C 10: 30,610,432 H117R probably damaging Het
Hsd3b6 A G 3: 98,806,225 F253L probably damaging Het
Itgal A G 7: 127,305,294 D313G possibly damaging Het
Kbtbd2 A T 6: 56,778,908 D614E probably damaging Het
Ksr2 A T 5: 117,756,270 I825F probably damaging Het
L3mbtl4 A T 17: 68,764,640 S521C probably benign Het
Lamc1 T C 1: 153,247,269 N725S probably damaging Het
Med1 T G 11: 98,158,422 E516A possibly damaging Het
Mical3 A T 6: 120,958,699 V1622E probably benign Het
Miip G A 4: 147,861,061 P373S probably damaging Het
Myo7a C A 7: 98,073,193 S1175I probably damaging Het
Ndst3 A T 3: 123,546,825 D781E probably benign Het
Olfr1066 T C 2: 86,455,515 Y252C probably damaging Het
Olfr1216 T C 2: 89,013,144 I307V probably benign Het
Olfr133 G C 17: 38,149,405 K272N probably damaging Het
Olfr282 A T 15: 98,437,679 D70V probably damaging Het
Olfr452 A T 6: 42,790,524 I162F probably benign Het
Olfr870 G T 9: 20,171,114 S152R probably damaging Het
Opalin A G 19: 41,067,757 L33P probably damaging Het
Pcdhb2 T A 18: 37,296,115 N23K probably damaging Het
Pdap1 A G 5: 145,136,881 probably benign Het
Pds5b A G 5: 150,746,732 E395G probably damaging Het
Pex1 C A 5: 3,618,880 R624S probably benign Het
Pitrm1 G A 13: 6,558,225 V329I probably benign Het
Pop1 G A 15: 34,515,824 probably benign Het
Prkaa1 A G 15: 5,160,601 probably null Het
Slc38a6 G T 12: 73,288,524 probably null Het
Slc5a9 T A 4: 111,893,187 Y158F probably damaging Het
Spata3 T A 1: 86,026,453 V114E probably damaging Het
Tbcb T A 7: 30,231,594 I34F possibly damaging Het
Tek T A 4: 94,863,666 Y1014* probably null Het
Togaram1 G T 12: 64,967,907 C644F probably damaging Het
Trim56 A C 5: 137,114,064 D199E possibly damaging Het
Tssk3 A T 4: 129,489,317 D187E probably benign Het
Ttn G A 2: 76,896,803 probably benign Het
Twf2 G A 9: 106,212,826 R126Q probably benign Het
Ugt1a10 T C 1: 88,056,116 M212T probably benign Het
Vmn1r177 A T 7: 23,866,347 F35I possibly damaging Het
Vmn1r44 T A 6: 89,893,933 H77Q possibly damaging Het
Zfp524 G A 7: 5,018,348 V292I probably benign Het
Zfp788 T G 7: 41,647,594 I56S probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAAACCGTATTTTCTGGTGTTTTGG -3'
(R):5'- AAGGCACATAACTGAAGCAAAAT -3'

Sequencing Primer
(F):5'- GACTTTGACCTTGAAGCCTT -3'
(R):5'- GCACATAACTGAAGCAAAATGAAGAC -3'
Posted On2015-09-24