Incidental Mutation 'R4580:Slitrk3'
ID343571
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73051206 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 78 (S78P)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably damaging
Transcript: ENSMUST00000059407
AA Change: S78P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: S78P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192477
AA Change: S78P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: S78P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGGAAGGTGTCATTTCTG -3'
(R):5'- TGCTGTGGATAATTCTTCTAAGCAC -3'

Sequencing Primer
(F):5'- GGAAGGTGTCATTTCTGAAGACATC -3'
(R):5'- GCACAATTGCTCTAGGATGGACTAC -3'
Posted On2015-09-24