Incidental Mutation 'R4580:Cdh15'
ID343596
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Namecadherin 15
SynonymsM cadherin, Mcad, Cdh14
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122847966-122867397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122865158 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 594 (L594P)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: L594P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: L594P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 122865323 intron probably benign
IGL01958:Cdh15 APN 8 122859350 missense probably damaging 1.00
IGL02588:Cdh15 APN 8 122856552 nonsense probably null
IGL02793:Cdh15 APN 8 122860982 missense probably damaging 1.00
IGL02947:Cdh15 APN 8 122865372 missense probably benign 0.00
R0310:Cdh15 UTSW 8 122865436 missense probably damaging 1.00
R0441:Cdh15 UTSW 8 122860966 missense probably damaging 1.00
R0766:Cdh15 UTSW 8 122861449 intron probably benign
R0898:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1023:Cdh15 UTSW 8 122865200 missense probably damaging 0.98
R1054:Cdh15 UTSW 8 122864337 missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R1081:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1101:Cdh15 UTSW 8 122860846 missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1209:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1210:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1312:Cdh15 UTSW 8 122861449 intron probably benign
R1317:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1318:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1393:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1428:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1429:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1695:Cdh15 UTSW 8 122862016 missense probably benign 0.05
R2157:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2170:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2178:Cdh15 UTSW 8 122864976 splice site probably null
R2252:Cdh15 UTSW 8 122857422 missense probably damaging 1.00
R2290:Cdh15 UTSW 8 122859317 missense probably damaging 1.00
R2317:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2330:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2345:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2349:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2353:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2354:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2566:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2567:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2568:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2893:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2894:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2937:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2938:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2990:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2992:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2993:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3029:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3030:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3195:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R3441:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3442:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3608:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3686:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4119:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4120:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4477:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4478:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4480:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4583:Cdh15 UTSW 8 122865028 missense probably damaging 0.98
R4619:Cdh15 UTSW 8 122860873 missense probably damaging 1.00
R4694:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4731:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R5076:Cdh15 UTSW 8 122864348 missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 122862063 missense probably null 1.00
R5375:Cdh15 UTSW 8 122865100 missense probably damaging 1.00
R5498:Cdh15 UTSW 8 122865178 missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 122856587 missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 122864347 missense probably benign 0.01
R6570:Cdh15 UTSW 8 122857391 missense probably damaging 1.00
R6708:Cdh15 UTSW 8 122863555 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCTTCTACAGTGAGCCATGC -3'
(R):5'- ATGCAACAGACTCTTGCCC -3'

Sequencing Primer
(F):5'- AGTGAGCCATGCACGCTTG -3'
(R):5'- AGACTCTTGCCCCGGGAATG -3'
Posted On2015-09-24