Incidental Mutation 'R4581:Ankrd17'
ID343664
Institutional Source Beutler Lab
Gene Symbol Ankrd17
Ensembl Gene ENSMUSG00000055204
Gene Nameankyrin repeat domain 17
SynonymsA130069E23Rik, 4933425K22Rik, Gtar
MMRRC Submission 041802-MU
Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4581 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90227166-90366577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90283120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 935 (D935G)
Ref Sequence ENSEMBL: ENSMUSP00000014421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014421
AA Change: D935G

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: D935G

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
low complexity region 1597 1611 N/A INTRINSIC
low complexity region 1616 1636 N/A INTRINSIC
KH 1720 1790 8.31e-14 SMART
low complexity region 1816 1827 N/A INTRINSIC
low complexity region 1834 1850 N/A INTRINSIC
low complexity region 1946 1989 N/A INTRINSIC
low complexity region 1996 2024 N/A INTRINSIC
low complexity region 2035 2052 N/A INTRINSIC
low complexity region 2068 2077 N/A INTRINSIC
low complexity region 2086 2110 N/A INTRINSIC
low complexity region 2175 2189 N/A INTRINSIC
low complexity region 2348 2365 N/A INTRINSIC
low complexity region 2392 2411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081914
SMART Domains Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
low complexity region 795 809 N/A INTRINSIC
ANK 827 856 2.13e-4 SMART
ANK 860 889 8.19e-6 SMART
ANK 894 923 1.68e-2 SMART
ANK 927 956 1.61e-4 SMART
ANK 962 991 1.43e-5 SMART
ANK 996 1025 1.83e-3 SMART
ANK 1029 1058 3.91e-3 SMART
ANK 1064 1093 1.93e-2 SMART
ANK 1097 1126 8.78e-6 SMART
ANK 1130 1159 7.59e-1 SMART
coiled coil region 1203 1271 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1365 1385 N/A INTRINSIC
KH 1469 1539 8.31e-14 SMART
low complexity region 1565 1576 N/A INTRINSIC
low complexity region 1583 1599 N/A INTRINSIC
low complexity region 1695 1738 N/A INTRINSIC
low complexity region 1745 1773 N/A INTRINSIC
low complexity region 1784 1801 N/A INTRINSIC
low complexity region 1817 1826 N/A INTRINSIC
low complexity region 1835 1859 N/A INTRINSIC
low complexity region 1924 1938 N/A INTRINSIC
low complexity region 2097 2114 N/A INTRINSIC
low complexity region 2141 2160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168058
AA Change: D935G
SMART Domains Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: D935G

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197021
AA Change: D826G
SMART Domains Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: D826G

DomainStartEndE-ValueType
ANK 120 149 5.4e-1 SMART
ANK 153 182 2e-3 SMART
ANK 187 216 2.2e-7 SMART
ANK 220 249 8.2e-8 SMART
ANK 253 282 2.2e-6 SMART
ANK 287 316 2.1e-6 SMART
ANK 320 349 9.9e-7 SMART
ANK 353 382 9.5e-5 SMART
ANK 386 415 2.4e-9 SMART
ANK 420 449 2.6e-5 SMART
ANK 450 479 1.1e-7 SMART
ANK 483 512 2.2e-7 SMART
ANK 516 545 3.5e-6 SMART
ANK 550 579 7.9e-6 SMART
ANK 583 612 8.9e-4 SMART
coiled coil region 691 774 N/A INTRINSIC
low complexity region 781 794 N/A INTRINSIC
low complexity region 846 859 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 937 951 N/A INTRINSIC
ANK 969 998 1.4e-6 SMART
ANK 1002 1031 5.3e-8 SMART
ANK 1036 1065 1e-4 SMART
ANK 1069 1098 1e-6 SMART
ANK 1104 1133 9.1e-8 SMART
ANK 1138 1167 1.2e-5 SMART
ANK 1171 1200 2.5e-5 SMART
ANK 1206 1235 1.2e-4 SMART
ANK 1239 1268 5.5e-8 SMART
ANK 1272 1301 4.7e-3 SMART
coiled coil region 1345 1413 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
KH 1611 1681 5.1e-16 SMART
low complexity region 1707 1718 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1837 1880 N/A INTRINSIC
low complexity region 1887 1915 N/A INTRINSIC
low complexity region 1926 1943 N/A INTRINSIC
low complexity region 1959 1968 N/A INTRINSIC
low complexity region 1977 2001 N/A INTRINSIC
low complexity region 2066 2080 N/A INTRINSIC
low complexity region 2239 2256 N/A INTRINSIC
low complexity region 2283 2302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200012
Predicted Effect probably benign
Transcript: ENSMUST00000218526
AA Change: D935G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]
Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Ankrd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ankrd17 APN 5 90233928 missense probably damaging 0.98
IGL00484:Ankrd17 APN 5 90268361 missense probably damaging 0.99
IGL01320:Ankrd17 APN 5 90260129 missense probably damaging 0.99
IGL01776:Ankrd17 APN 5 90283364 nonsense probably null
IGL02093:Ankrd17 APN 5 90242963 missense possibly damaging 0.93
IGL02292:Ankrd17 APN 5 90252859 unclassified probably benign
IGL02302:Ankrd17 APN 5 90283198 missense probably benign 0.23
IGL02472:Ankrd17 APN 5 90264151 missense probably damaging 1.00
IGL02705:Ankrd17 APN 5 90283115 missense probably benign 0.15
IGL02727:Ankrd17 APN 5 90244292 missense possibly damaging 0.93
IGL02884:Ankrd17 APN 5 90264757 missense probably damaging 1.00
3-1:Ankrd17 UTSW 5 90243154 missense probably damaging 0.99
PIT1430001:Ankrd17 UTSW 5 90252973 missense possibly damaging 0.91
R0025:Ankrd17 UTSW 5 90250405 missense probably damaging 0.99
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0271:Ankrd17 UTSW 5 90254799 missense possibly damaging 0.90
R0684:Ankrd17 UTSW 5 90263998 missense probably damaging 0.99
R1239:Ankrd17 UTSW 5 90288676 missense probably damaging 0.99
R1457:Ankrd17 UTSW 5 90285846 missense possibly damaging 0.92
R1505:Ankrd17 UTSW 5 90300026 missense possibly damaging 0.53
R1766:Ankrd17 UTSW 5 90264797 missense possibly damaging 0.95
R1770:Ankrd17 UTSW 5 90243376 missense possibly damaging 0.84
R1780:Ankrd17 UTSW 5 90232415 missense probably damaging 0.96
R1916:Ankrd17 UTSW 5 90260141 missense probably damaging 1.00
R1926:Ankrd17 UTSW 5 90244169 missense probably damaging 1.00
R2090:Ankrd17 UTSW 5 90298046 missense possibly damaging 0.92
R2153:Ankrd17 UTSW 5 90234059 missense probably damaging 0.98
R2279:Ankrd17 UTSW 5 90264717 missense probably damaging 1.00
R2420:Ankrd17 UTSW 5 90289320 missense possibly damaging 0.94
R3012:Ankrd17 UTSW 5 90230868 missense probably damaging 1.00
R3417:Ankrd17 UTSW 5 90243913 missense possibly damaging 0.86
R3704:Ankrd17 UTSW 5 90243969 missense possibly damaging 0.72
R4850:Ankrd17 UTSW 5 90264786 missense probably damaging 1.00
R4926:Ankrd17 UTSW 5 90300032 missense probably damaging 1.00
R5023:Ankrd17 UTSW 5 90282868 missense probably damaging 1.00
R5068:Ankrd17 UTSW 5 90254808 missense probably damaging 0.96
R5109:Ankrd17 UTSW 5 90243536 missense possibly damaging 0.83
R5111:Ankrd17 UTSW 5 90242999 missense possibly damaging 0.85
R5214:Ankrd17 UTSW 5 90283460 missense possibly damaging 0.48
R5362:Ankrd17 UTSW 5 90265545 missense probably damaging 1.00
R5576:Ankrd17 UTSW 5 90243224 missense probably benign 0.00
R5615:Ankrd17 UTSW 5 90283436 missense possibly damaging 0.88
R5874:Ankrd17 UTSW 5 90268797 intron probably benign
R5932:Ankrd17 UTSW 5 90265436 missense probably damaging 1.00
R5944:Ankrd17 UTSW 5 90285843 missense probably damaging 1.00
R5993:Ankrd17 UTSW 5 90339672 intron probably benign
R6052:Ankrd17 UTSW 5 90253832 missense probably benign 0.03
R6088:Ankrd17 UTSW 5 90253688 missense possibly damaging 0.95
R6306:Ankrd17 UTSW 5 90244154 missense probably benign 0.03
R6418:Ankrd17 UTSW 5 90278345 missense possibly damaging 0.89
R6663:Ankrd17 UTSW 5 90264064 missense probably damaging 1.00
R6758:Ankrd17 UTSW 5 90263313 missense probably damaging 1.00
R6782:Ankrd17 UTSW 5 90254738 missense possibly damaging 0.91
R6793:Ankrd17 UTSW 5 90265512 missense probably damaging 1.00
R6929:Ankrd17 UTSW 5 90285525 missense possibly damaging 0.86
R7008:Ankrd17 UTSW 5 90260096 missense possibly damaging 0.93
R7051:Ankrd17 UTSW 5 90366451 unclassified probably benign
R7077:Ankrd17 UTSW 5 90285864 missense possibly damaging 0.92
R7134:Ankrd17 UTSW 5 90232314 missense probably damaging 0.99
R7134:Ankrd17 UTSW 5 90285523 missense probably benign 0.03
R7138:Ankrd17 UTSW 5 90242977 missense probably benign 0.38
R7143:Ankrd17 UTSW 5 90285961 missense possibly damaging 0.85
R7173:Ankrd17 UTSW 5 90260117 missense possibly damaging 0.95
R7176:Ankrd17 UTSW 5 90268735 missense probably damaging 0.99
R7365:Ankrd17 UTSW 5 90291151 missense possibly damaging 0.45
R7390:Ankrd17 UTSW 5 90282920 missense probably benign 0.13
R7430:Ankrd17 UTSW 5 90295657 missense possibly damaging 0.80
R7468:Ankrd17 UTSW 5 90243043 missense probably benign
R7483:Ankrd17 UTSW 5 90299996 missense probably benign 0.00
X0019:Ankrd17 UTSW 5 90298654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAATTCCTTGCCCCAGC -3'
(R):5'- AAAGATTCTGGAGGAGCTGC -3'

Sequencing Primer
(F):5'- CCCTGCCAACTGTGCTTGG -3'
(R):5'- GAGAGCTACAACTGAAAACTCAG -3'
Posted On2015-09-24