Incidental Mutation 'R4582:Lipe'
ID343731
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Namelipase, hormone sensitive
Synonyms4933403G17Rik, HSL
MMRRC Submission 041803-MU
Accession Numbers

Genbank: NM_010719, NM_001039507; MGI: 96790

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25379527-25398710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25397702 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 272 (L272P)
Ref Sequence ENSEMBL: ENSMUSP00000123485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074040
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105177
AA Change: L272P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123
AA Change: L272P

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
AA Change: L272P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123
AA Change: L272P

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200880
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25383552 missense probably damaging 1.00
IGL00517:Lipe APN 7 25388560 unclassified probably null
IGL00817:Lipe APN 7 25388449 missense probably damaging 1.00
IGL01459:Lipe APN 7 25383542 missense probably damaging 1.00
IGL01946:Lipe APN 7 25383276 missense possibly damaging 0.90
IGL02931:Lipe APN 7 25383335 splice site probably benign
IGL02973:Lipe APN 7 25383632 missense probably damaging 0.98
IGL03091:Lipe APN 7 25380755 missense probably damaging 1.00
reservoir UTSW 7 25380143 missense probably damaging 1.00
3-1:Lipe UTSW 7 25397820 missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25395546 missense probably benign
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0432:Lipe UTSW 7 25398488 missense probably benign 0.00
R0528:Lipe UTSW 7 25398476 missense possibly damaging 0.92
R0534:Lipe UTSW 7 25388186 missense possibly damaging 0.66
R1487:Lipe UTSW 7 25384815 missense possibly damaging 0.47
R1502:Lipe UTSW 7 25398147 missense possibly damaging 0.66
R1606:Lipe UTSW 7 25388144 missense probably damaging 1.00
R1713:Lipe UTSW 7 25385325 missense probably damaging 0.99
R2147:Lipe UTSW 7 25388521 missense probably benign 0.01
R3031:Lipe UTSW 7 25384895 missense possibly damaging 0.65
R3110:Lipe UTSW 7 25398423 missense probably benign
R3112:Lipe UTSW 7 25398423 missense probably benign
R3792:Lipe UTSW 7 25397620 missense possibly damaging 0.82
R4453:Lipe UTSW 7 25397690 missense probably damaging 0.99
R4816:Lipe UTSW 7 25380143 missense probably damaging 1.00
R5639:Lipe UTSW 7 25383325 missense probably benign 0.00
R5653:Lipe UTSW 7 25398408 missense probably benign 0.08
R6322:Lipe UTSW 7 25380536 missense probably damaging 1.00
R6575:Lipe UTSW 7 25383324 missense probably benign 0.03
R7065:Lipe UTSW 7 25385178 critical splice donor site probably null
R7250:Lipe UTSW 7 25388660 start gained probably benign
R7485:Lipe UTSW 7 25380611 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCCTTCAGAGATGACCTGAGC -3'
(R):5'- AGGGATCTTTGACTGAGTCAGG -3'

Sequencing Primer
(F):5'- TCAGAGATGACCTGAGCGTTATGATC -3'
(R):5'- GGTTTCTAACAAGGCTGCATGACC -3'
Posted On2015-09-24