Incidental Mutation 'R4582:Olfr768'
ID343742
Institutional Source Beutler Lab
Gene Symbol Olfr768
Ensembl Gene ENSMUSG00000050198
Gene Nameolfactory receptor 768
SynonymsGA_x6K02T2PULF-10779441-10778503, MOR114-4
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129090222-129099375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129093158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 272 (V272E)
Ref Sequence ENSEMBL: ENSMUSP00000089619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063031]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063031
AA Change: V272E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089619
Gene: ENSMUSG00000050198
AA Change: V272E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216681
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Olfr768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr768 APN 10 129093396 missense probably benign 0.08
IGL01947:Olfr768 APN 10 129093878 missense possibly damaging 0.52
IGL03026:Olfr768 APN 10 129093188 missense possibly damaging 0.60
R1353:Olfr768 UTSW 10 129093864 missense probably benign 0.14
R1426:Olfr768 UTSW 10 129093690 missense probably damaging 1.00
R1766:Olfr768 UTSW 10 129093747 missense probably benign 0.24
R2356:Olfr768 UTSW 10 129093892 missense probably benign 0.40
R3522:Olfr768 UTSW 10 129093842 missense possibly damaging 0.93
R3751:Olfr768 UTSW 10 129093306 missense probably damaging 1.00
R3779:Olfr768 UTSW 10 129093296 missense possibly damaging 0.94
R4772:Olfr768 UTSW 10 129093668 missense possibly damaging 0.92
R4792:Olfr768 UTSW 10 129093620 missense probably damaging 1.00
R5749:Olfr768 UTSW 10 129093097 missense probably damaging 0.98
R6571:Olfr768 UTSW 10 129093121 missense probably damaging 0.98
R6619:Olfr768 UTSW 10 129093454 missense possibly damaging 0.95
R7052:Olfr768 UTSW 10 129093875 missense probably damaging 0.98
R7096:Olfr768 UTSW 10 129093846 missense probably damaging 0.97
R7409:Olfr768 UTSW 10 129093212 missense probably damaging 1.00
X0024:Olfr768 UTSW 10 129093115 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAGAGGTTTGTTTCTAG -3'
(R):5'- ACACTCATGTTCACGTTACTGTG -3'

Sequencing Primer
(F):5'- CCCAGAGGTTTGTTTCTAGATAATTG -3'
(R):5'- GTGTGTGGTAATGTCTTACACATAC -3'
Posted On2015-09-24