Incidental Mutation 'R4582:Ttc7b'
ID343749
Institutional Source Beutler Lab
Gene Symbol Ttc7b
Ensembl Gene ENSMUSG00000033530
Gene Nametetratricopeptide repeat domain 7B
SynonymsTtc7l1
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4582 (G1)
Quality Score216
Status Not validated
Chromosome12
Chromosomal Location100300770-100520826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100500117 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 79 (R79C)
Ref Sequence ENSEMBL: ENSMUSP00000152299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062957] [ENSMUST00000223020]
Predicted Effect probably damaging
Transcript: ENSMUST00000062957
AA Change: R79C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052107
Gene: ENSMUSG00000033530
AA Change: R79C

DomainStartEndE-ValueType
TPR 397 430 8.76e-1 SMART
Blast:TPR 471 514 5e-9 BLAST
TPR 515 548 2.77e1 SMART
TPR 549 582 2.01e0 SMART
TPR 696 729 9.7e0 SMART
TPR 730 763 7.98e-4 SMART
TPR 764 797 6.1e0 SMART
TPR 798 831 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222036
Predicted Effect probably damaging
Transcript: ENSMUST00000223020
AA Change: R79C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223444
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Ttc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Ttc7b APN 12 100376213 missense probably benign 0.03
IGL01377:Ttc7b APN 12 100355112 missense probably benign 0.21
IGL01617:Ttc7b APN 12 100385956 missense possibly damaging 0.94
IGL02928:Ttc7b APN 12 100403415 missense probably damaging 1.00
IGL03183:Ttc7b APN 12 100373709 splice site probably null
IGL03341:Ttc7b APN 12 100325735 missense possibly damaging 0.66
R0302:Ttc7b UTSW 12 100387179 missense possibly damaging 0.94
R0620:Ttc7b UTSW 12 100500073 splice site probably null
R0625:Ttc7b UTSW 12 100355046 missense probably benign 0.04
R1016:Ttc7b UTSW 12 100403358 missense probably null 1.00
R1131:Ttc7b UTSW 12 100382119 critical splice donor site probably null
R1241:Ttc7b UTSW 12 100403439 missense possibly damaging 0.90
R1710:Ttc7b UTSW 12 100403408 missense probably damaging 0.98
R1803:Ttc7b UTSW 12 100407002 missense possibly damaging 0.94
R1887:Ttc7b UTSW 12 100415130 splice site probably null
R1920:Ttc7b UTSW 12 100415130 splice site probably null
R1921:Ttc7b UTSW 12 100415130 splice site probably null
R1922:Ttc7b UTSW 12 100415130 splice site probably null
R2062:Ttc7b UTSW 12 100325689 missense probably damaging 1.00
R2239:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R2380:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R4581:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4598:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4599:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4600:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4601:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4779:Ttc7b UTSW 12 100403362 missense probably damaging 1.00
R5027:Ttc7b UTSW 12 100301742 missense probably damaging 1.00
R5244:Ttc7b UTSW 12 100348010 missense probably damaging 0.99
R5387:Ttc7b UTSW 12 100446963 missense possibly damaging 0.64
R5739:Ttc7b UTSW 12 100384233 missense probably damaging 1.00
R5997:Ttc7b UTSW 12 100373560 missense probably damaging 0.96
R6223:Ttc7b UTSW 12 100387109 critical splice donor site probably null
R6238:Ttc7b UTSW 12 100495422 missense probably benign 0.31
R6318:Ttc7b UTSW 12 100325677 missense probably damaging 0.99
R6494:Ttc7b UTSW 12 100495407 missense possibly damaging 0.73
R7153:Ttc7b UTSW 12 100355034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATACACTGATCAGGCAGG -3'
(R):5'- CGGAAGCTTAGTGCATGTGG -3'

Sequencing Primer
(F):5'- ACTGATCAGGCAGGGCGTG -3'
(R):5'- GAGGTGCTCAGGGCTTTCC -3'
Posted On2015-09-24