Incidental Mutation 'R4582:Sacs'
ID343754
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 041803-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61191698 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 402 (G402D)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000121091] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089394
AA Change: G402D

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279
AA Change: G402D

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119509
AA Change: G402D

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279
AA Change: G402D

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: G402D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: G402D

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121091
AA Change: G399D

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113925
Gene: ENSMUSG00000048279
AA Change: G399D

DomainStartEndE-ValueType
SCOP:d1lm8b_ 5 63 3e-3 SMART
Blast:UBQ 6 78 4e-31 BLAST
SCOP:d1byqa_ 84 199 4e-3 SMART
Blast:HATPase_c 113 208 2e-10 BLAST
low complexity region 605 620 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
R7023:Sacs UTSW 14 61208815 missense probably benign 0.04
R7047:Sacs UTSW 14 61213002 missense probably damaging 1.00
R7051:Sacs UTSW 14 61208928 missense probably benign 0.25
R7069:Sacs UTSW 14 61212496 missense probably damaging 1.00
R7082:Sacs UTSW 14 61210517 missense possibly damaging 0.94
R7108:Sacs UTSW 14 61211009 nonsense probably null
R7122:Sacs UTSW 14 61210396 missense probably damaging 1.00
R7194:Sacs UTSW 14 61210089 missense possibly damaging 0.95
R7214:Sacs UTSW 14 61191792 missense probably benign
R7221:Sacs UTSW 14 61208806 missense probably damaging 0.99
R7274:Sacs UTSW 14 61214081 missense possibly damaging 0.88
R7344:Sacs UTSW 14 61207444 missense possibly damaging 0.81
R7440:Sacs UTSW 14 61191605 missense probably benign 0.10
R7474:Sacs UTSW 14 61211178 missense probably benign 0.04
R7512:Sacs UTSW 14 61204430 missense not run
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTGAAACATGAACGG -3'
(R):5'- TTGTCAGTCAGGCCAAAGAAACC -3'

Sequencing Primer
(F):5'- CGGCCAAATTCTATCAAGATTCTGGG -3'
(R):5'- CCACTGATATGAACTGGAAGTCCTG -3'
Posted On2015-09-24