Incidental Mutation 'R4582:Abra'
ID343756
Institutional Source Beutler Lab
Gene Symbol Abra
Ensembl Gene ENSMUSG00000042895
Gene Nameactin-binding Rho activating protein
SynonymsSTARS, C130068O12Rik
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location41864076-41869720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41869285 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 128 (D128E)
Ref Sequence ENSEMBL: ENSMUSP00000051973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054742]
Predicted Effect probably benign
Transcript: ENSMUST00000054742
AA Change: D128E

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051973
Gene: ENSMUSG00000042895
AA Change: D128E

DomainStartEndE-ValueType
Costars 298 374 6.22e-45 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired arteriogenesis following occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Abra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Abra APN 15 41866017 missense probably damaging 0.99
IGL02022:Abra APN 15 41869406 missense probably benign
IGL02370:Abra APN 15 41869244 missense probably damaging 1.00
IGL02406:Abra APN 15 41869187 missense probably damaging 1.00
R1860:Abra UTSW 15 41869034 missense probably damaging 1.00
R1861:Abra UTSW 15 41869034 missense probably damaging 1.00
R2385:Abra UTSW 15 41869353 missense probably damaging 0.97
R3718:Abra UTSW 15 41866293 missense probably benign
R4621:Abra UTSW 15 41869224 missense probably benign 0.10
R4724:Abra UTSW 15 41865906 missense probably damaging 1.00
R5926:Abra UTSW 15 41866254 missense probably damaging 1.00
R6417:Abra UTSW 15 41866056 missense probably benign 0.01
R6649:Abra UTSW 15 41869233 missense probably benign
R7348:Abra UTSW 15 41866159 missense probably damaging 1.00
R7487:Abra UTSW 15 41869553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTACTGGGAGAGCAAGG -3'
(R):5'- AACGCTCCTAAAGAAGCCGG -3'

Sequencing Primer
(F):5'- ACAGGCGCTGCATCTTG -3'
(R):5'- GCTCCTAAAGAAGCCGGTCCTTAC -3'
Posted On2015-09-24