Incidental Mutation 'R4582:Tm9sf3'
ID343761
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Nametransmembrane 9 superfamily member 3
Synonyms1810073M23Rik, 2810031D16Rik, Smbp
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41210842-41264004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41256166 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 91 (G91C)
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
Predicted Effect probably damaging
Transcript: ENSMUST00000025989
AA Change: G91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016
AA Change: G91C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41256276 missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41246637 splice site probably benign
PIT4687001:Tm9sf3 UTSW 19 41218191 missense probably damaging 1.00
R0504:Tm9sf3 UTSW 19 41247892 splice site probably benign
R0564:Tm9sf3 UTSW 19 41245525 splice site probably benign
R0586:Tm9sf3 UTSW 19 41256143 critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41223195 missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41238784 missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41223179 missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41256229 missense probably benign 0.01
R2022:Tm9sf3 UTSW 19 41238792 missense probably damaging 1.00
R2172:Tm9sf3 UTSW 19 41217420 missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41217116 missense possibly damaging 0.95
R3878:Tm9sf3 UTSW 19 41246713 missense probably damaging 0.98
R4384:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4385:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41215116 missense probably benign 0.03
R5876:Tm9sf3 UTSW 19 41240584 missense probably damaging 1.00
R6305:Tm9sf3 UTSW 19 41245442 critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41218278 missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41223199 missense probably benign 0.44
R7121:Tm9sf3 UTSW 19 41245505 nonsense probably null
R7287:Tm9sf3 UTSW 19 41217379 missense probably damaging 1.00
R7303:Tm9sf3 UTSW 19 41238759 missense probably damaging 0.97
X0026:Tm9sf3 UTSW 19 41246762 missense possibly damaging 0.91
X0026:Tm9sf3 UTSW 19 41246763 nonsense probably null
Z1088:Tm9sf3 UTSW 19 41232378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCCCATATACGTATCTAGTAGG -3'
(R):5'- GCATCTTGAATGTGGACAGTTTAC -3'

Sequencing Primer
(F):5'- GAACTATGTTAGGGAAGCATTC -3'
(R):5'- TGAATGTGGACAGTTTACTTACATG -3'
Posted On2015-09-24