Incidental Mutation 'R0064:D430041D05Rik'
ID34386
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene NameRIKEN cDNA D430041D05 gene
SynonymsG2
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R0064 (G1)
Quality Score152
Status Validated
Chromosome2
Chromosomal Location104143073-104411013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104249157 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1194 (T1194P)
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
Predicted Effect probably damaging
Transcript: ENSMUST00000089726
AA Change: T510P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: T510P

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136156
AA Change: T510P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000141159
AA Change: T395P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: T395P

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149165
Predicted Effect probably damaging
Transcript: ENSMUST00000230671
AA Change: T1194P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104201303 missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104258166 nonsense probably null
IGL01669:D430041D05Rik APN 2 104254961 missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104230404 missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104208214 splice site probably benign
IGL02268:D430041D05Rik APN 2 104241155 missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104255006 missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104249345 missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104230286 missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104248266 missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104230305 missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104214259 missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104241163 missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104221211 missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104248374 missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104255044 missense probably benign
R0135:D430041D05Rik UTSW 2 104255034 missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104205200 missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104201244 missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104255340 missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 104168164 missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 104167947 missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104230306 missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104230428 missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104249345 missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104258329 missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104201303 missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 104155018 missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104208083 missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104221208 small deletion probably benign
R1604:D430041D05Rik UTSW 2 104205142 missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104255570 missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 104152963 missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104221211 missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 104168101 missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104230455 missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 104148830 missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104255315 missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104255058 missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104257368 missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104256339 missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104192433 critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104233479 missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104258443 missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104214096 missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104201110 critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104255409 missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104255387 missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104258502 missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104256600 missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104255409 missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104248284 missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104248285 missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 104168067 missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104256292 missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 104168203 splice site probably null
R6804:D430041D05Rik UTSW 2 104149026 missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104201259 missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104241155 missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104192538 missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104258353 missense probably benign 0.06
R7250:D430041D05Rik UTSW 2 104256616 missense possibly damaging 0.92
R7251:D430041D05Rik UTSW 2 104221166 missense probably damaging 1.00
R7313:D430041D05Rik UTSW 2 104255565 missense probably benign
R7359:D430041D05Rik UTSW 2 104214137 missense probably damaging 1.00
R7361:D430041D05Rik UTSW 2 104255018 missense possibly damaging 0.46
R7436:D430041D05Rik UTSW 2 104257102 missense probably benign 0.02
X0024:D430041D05Rik UTSW 2 104192566 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGATTACAACCATTAGGCAGGAGGC -3'
(R):5'- GCGTCAGAATGAATGCACAGTCCC -3'

Sequencing Primer
(F):5'- AGGCTTGGACCTCTGATGAAC -3'
(R):5'- atgaatgcACAGTCCCCCAAC -3'
Posted On2013-05-09