Incidental Mutation 'R4583:Slc29a1'
ID343876
Institutional Source Beutler Lab
Gene Symbol Slc29a1
Ensembl Gene ENSMUSG00000023942
Gene Namesolute carrier family 29 (nucleoside transporters), member 1
SynonymsENT1, 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter
MMRRC Submission 041804-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4583 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45585200-45599606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45589956 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000129345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051574] [ENSMUST00000064889] [ENSMUST00000097317] [ENSMUST00000163492] [ENSMUST00000163905] [ENSMUST00000164217] [ENSMUST00000164618] [ENSMUST00000164769] [ENSMUST00000166119] [ENSMUST00000166633] [ENSMUST00000167195] [ENSMUST00000167332] [ENSMUST00000167692] [ENSMUST00000168274] [ENSMUST00000169729] [ENSMUST00000170113] [ENSMUST00000170488] [ENSMUST00000171081] [ENSMUST00000171847] [ENSMUST00000172301]
Predicted Effect probably benign
Transcript: ENSMUST00000051574
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063096
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064889
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063757
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087588
Predicted Effect probably benign
Transcript: ENSMUST00000097317
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094923
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163492
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129242
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163905
AA Change: V94A

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129240
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164217
AA Change: V94A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131646
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164618
AA Change: V94A

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126934
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164769
AA Change: V94A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131116
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 358 2.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166119
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128763
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166633
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131075
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 195 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167195
AA Change: V62A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133162
Gene: ENSMUSG00000023942
AA Change: V62A

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167332
SMART Domains Protein: ENSMUSP00000131483
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167692
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131976
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167863
Predicted Effect probably benign
Transcript: ENSMUST00000168274
Predicted Effect probably benign
Transcript: ENSMUST00000169729
AA Change: V62A

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127343
Gene: ENSMUSG00000023942
AA Change: V62A

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170113
SMART Domains Protein: ENSMUSP00000128304
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170425
Predicted Effect probably benign
Transcript: ENSMUST00000170488
Predicted Effect probably benign
Transcript: ENSMUST00000171081
AA Change: V94A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131217
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171847
AA Change: V94A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126703
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171978
Predicted Effect possibly damaging
Transcript: ENSMUST00000172301
AA Change: V94A

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129345
Gene: ENSMUSG00000023942
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a slightly decreased body weight, increased alcohol preference and alcohol consumption, and reduced hypnotic and ataxic responses to ethanol associated with a reduction in adenosine tone. Adenosine uptake is almost completely abolished in mice homozygous for a knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,574,592 L86P unknown Het
Aimp1 C T 3: 132,677,047 E23K probably damaging Het
Ap2b1 A T 11: 83,397,779 N884I probably benign Het
Apoe G T 7: 19,697,498 Q65K possibly damaging Het
Arhgef1 T A 7: 24,912,571 D93E probably benign Het
Arhgef12 G T 9: 42,977,662 T1085K probably damaging Het
Arid5a T C 1: 36,317,664 probably null Het
Atp9a A T 2: 168,689,360 probably null Het
Baz1a T C 12: 54,922,540 I635V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cckar T A 5: 53,699,782 M429L probably benign Het
Ccl3 A T 11: 83,648,338 L65Q probably benign Het
Ccr3 A G 9: 124,029,440 T271A probably benign Het
Cd8b1 T A 6: 71,326,097 I52N probably damaging Het
Cdh15 G A 8: 122,865,028 E551K probably damaging Het
Cdh17 A G 4: 11,810,466 K719R probably benign Het
Cfap43 T C 19: 47,837,216 R38G probably null Het
Chd6 T C 2: 161,014,194 E715G probably damaging Het
Cldn34b2 T A X: 155,125,629 R68* probably null Het
Col19a1 T G 1: 24,561,329 D44A unknown Het
Colgalt2 C T 1: 152,506,876 S493F probably damaging Het
Cr1l T C 1: 195,129,831 I99M probably damaging Het
Crybg1 T C 10: 43,997,620 E1164G probably damaging Het
Cym G T 3: 107,211,402 D367E probably damaging Het
Dennd2a G T 6: 39,522,842 T263K probably damaging Het
Dhx9 T A 1: 153,460,303 M869L probably damaging Het
Dnm2 A G 9: 21,504,446 H692R probably damaging Het
Ern1 A T 11: 106,407,205 S697T probably damaging Het
F12 G A 13: 55,421,130 T273I probably benign Het
Fam151b A T 13: 92,468,109 L124Q probably damaging Het
Fancg A G 4: 43,002,991 V622A probably benign Het
Fbxo2 T A 4: 148,164,899 N159K possibly damaging Het
Fgd2 C A 17: 29,367,078 T212K possibly damaging Het
Fhl3 T A 4: 124,707,549 D178E probably benign Het
Filip1 G T 9: 79,815,809 A1176D possibly damaging Het
Fndc1 T C 17: 7,739,249 Y1722C probably damaging Het
Frem3 T C 8: 80,613,514 V812A probably benign Het
Fsip2 A G 2: 82,978,673 I1779V probably benign Het
Gli2 C T 1: 118,842,068 V585I probably benign Het
Gm15056 C G 8: 20,900,681 S80T probably benign Het
Gm4951 T C 18: 60,246,080 I229T possibly damaging Het
Gm5145 A G 17: 20,570,453 E31G probably benign Het
Gmfg A G 7: 28,445,944 Y71C probably damaging Het
Grk1 A G 8: 13,409,322 E291G probably damaging Het
Gtpbp1 A G 15: 79,715,951 E393G possibly damaging Het
Gtpbp2 A G 17: 46,161,145 D2G probably damaging Het
Hc A T 2: 35,028,177 V698E probably benign Het
Helz G A 11: 107,646,069 R249H probably damaging Het
Hmcn2 A G 2: 31,413,265 I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,663,606 R286G probably benign Het
Hus1b A T 13: 30,947,518 W53R probably damaging Het
Hydin C T 8: 110,595,225 T4503I probably benign Het
Ighmbp2 G C 19: 3,265,324 P699A probably benign Het
Igkv1-122 A T 6: 68,017,458 Y110F probably benign Het
Igkv8-28 T C 6: 70,143,620 Y113C probably damaging Het
Il16 A G 7: 83,682,899 S158P probably damaging Het
Kalrn T A 16: 34,235,267 H876L probably damaging Het
Kdm5d T A Y: 914,134 L357H probably damaging Het
Krt78 T C 15: 101,946,620 T919A possibly damaging Het
L3mbtl2 T C 15: 81,684,906 C594R probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lgals3 A T 14: 47,381,687 probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lpcat3 T G 6: 124,703,323 W429G possibly damaging Het
Lrp1 T C 10: 127,541,372 T4149A probably benign Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Micalcl A G 7: 112,412,947 N668S probably benign Het
Ms4a10 A T 19: 10,968,189 I76N possibly damaging Het
Mthfr T G 4: 148,051,872 L362V possibly damaging Het
Myh3 T A 11: 67,096,453 Y1376* probably null Het
Mymk C A 2: 27,062,280 V192F probably benign Het
Myo1c A G 11: 75,671,862 D966G possibly damaging Het
Ncam2 A G 16: 81,517,557 N474D probably damaging Het
Nmnat1 T C 4: 149,469,151 N168S possibly damaging Het
Nmur1 C T 1: 86,386,645 V323M possibly damaging Het
Npr2 C A 4: 43,633,522 probably null Het
Nsd3 T A 8: 25,710,676 M1265K probably benign Het
Olfr1206 G T 2: 88,865,494 M296I probably benign Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1462 T A 19: 13,190,698 F10L probably damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr155 A G 4: 43,855,262 T318A probably benign Het
Olfr345 A C 2: 36,640,614 T192P probably damaging Het
Olfr394 T C 11: 73,887,803 T190A probably damaging Het
Olfr812 T C 10: 129,842,475 D189G probably damaging Het
Otub1 G A 19: 7,204,436 A25V possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl2 A G 2: 122,126,745 S103P probably benign Het
Pcdhb15 A T 18: 37,475,575 H620L possibly damaging Het
Pdgfc A T 3: 81,141,528 D81V possibly damaging Het
Pdia2 T C 17: 26,196,502 D447G probably damaging Het
Pold1 C A 7: 44,538,913 A514S probably damaging Het
Pomgnt1 C T 4: 116,158,494 T552I probably benign Het
Ppl T C 16: 5,104,536 E294G probably benign Het
Pramef8 A G 4: 143,416,754 Y30C probably damaging Het
Prkcb A G 7: 122,457,224 S100G probably benign Het
Psg16 T G 7: 17,095,172 I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 123,001,952 probably benign Het
Reck T C 4: 43,931,062 probably null Het
Rrbp1 C T 2: 143,988,751 G499S probably benign Het
Sema6d G T 2: 124,664,162 R630L probably damaging Het
Slc35a1 T A 4: 34,664,146 Q324L probably benign Het
Slc35c1 A T 2: 92,458,921 L80Q probably damaging Het
Slc7a10 G T 7: 35,197,952 probably null Het
Srrm2 C T 17: 23,819,619 probably benign Het
Stk38 T G 17: 28,982,156 D182A probably damaging Het
Tas2r104 C T 6: 131,685,435 G104S probably benign Het
Tmem121b T C 6: 120,492,094 E554G probably damaging Het
Tor1aip2 A G 1: 156,065,142 H398R probably benign Het
Tram2 C T 1: 21,013,449 V83I probably benign Het
Ube3a C T 7: 59,286,063 T565I probably damaging Het
Ubr4 T C 4: 139,380,853 V56A possibly damaging Het
Vmn1r128 T C 7: 21,349,719 V116A possibly damaging Het
Vmn1r170 C T 7: 23,606,662 T163I probably benign Het
Vmn2r75 T A 7: 86,164,082 D504V possibly damaging Het
Vps36 G A 8: 22,218,420 M363I probably benign Het
Wdsub1 A G 2: 59,878,317 S71P probably damaging Het
Zdhhc12 A G 2: 30,091,484 F189L probably benign Het
Zfp521 T C 18: 13,844,330 M1009V probably benign Het
Other mutations in Slc29a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Slc29a1 APN 17 45589992 missense probably damaging 1.00
IGL01617:Slc29a1 APN 17 45589449 missense probably benign 0.02
IGL02154:Slc29a1 APN 17 45586163 missense probably damaging 1.00
veteran UTSW 17 45589921 critical splice donor site probably null
veterinarian UTSW 17 45586109 missense probably damaging 1.00
workhorse UTSW 17 45589066 nonsense probably null
R0288:Slc29a1 UTSW 17 45589804 missense probably damaging 1.00
R1168:Slc29a1 UTSW 17 45590278 missense probably damaging 1.00
R1676:Slc29a1 UTSW 17 45589010 missense probably damaging 0.98
R1777:Slc29a1 UTSW 17 45587308 missense probably damaging 1.00
R2032:Slc29a1 UTSW 17 45586109 missense probably damaging 1.00
R2413:Slc29a1 UTSW 17 45585717 missense probably damaging 1.00
R3917:Slc29a1 UTSW 17 45588973 unclassified probably null
R4513:Slc29a1 UTSW 17 45589066 nonsense probably null
R5244:Slc29a1 UTSW 17 45588413 unclassified probably benign
R6174:Slc29a1 UTSW 17 45589928 missense probably damaging 1.00
R6284:Slc29a1 UTSW 17 45589921 critical splice donor site probably null
R6446:Slc29a1 UTSW 17 45589245 missense possibly damaging 0.88
R6607:Slc29a1 UTSW 17 45588927 unclassified probably null
R7133:Slc29a1 UTSW 17 45589971 missense not run
R7153:Slc29a1 UTSW 17 45585762 missense not run
X0067:Slc29a1 UTSW 17 45590325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATCAGAGCATCCATCTCC -3'
(R):5'- ATTTCACAAACCGCCTGGAC -3'

Sequencing Primer
(F):5'- GATCAGAGCATCCATCTCCACCTTC -3'
(R):5'- ACGTGTCCCAGAATGTGTC -3'
Posted On2015-09-24