Incidental Mutation 'R0064:Slc7a14'
ID34390
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0064 (G1)
Quality Score210
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31227060 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 367 (D367G)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: D367G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: D367G

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: D367G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: D367G

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCATTTTGGACCTATTGCCCACC -3'
(R):5'- ATTACGCCATTGACACAGAGTCCC -3'

Sequencing Primer
(F):5'- TATTGCCCACCCAAGGGAAATG -3'
(R):5'- CCCGCTCATGGAGATGTTTG -3'
Posted On2013-05-09