Incidental Mutation 'R4584:A2m'
ID343913
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 041805-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4584 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121657406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 632 (D632E)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: D632E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: D632E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203413
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (86/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,160,017 N343D probably damaging Het
9530002B09Rik T A 4: 122,701,186 D78E possibly damaging Het
Alpk2 A G 18: 65,306,964 S453P probably damaging Het
Birc2 A T 9: 7,833,674 F269I probably damaging Het
Ccdc66 G A 14: 27,500,511 P92S probably benign Het
Cdc34 T A 10: 79,688,035 D108E possibly damaging Het
Cdk5rap2 A C 4: 70,266,760 V1151G probably damaging Het
Cemip T C 7: 83,958,539 K753R probably damaging Het
Cep295 A T 9: 15,334,799 L787Q possibly damaging Het
Cideb T C 14: 55,758,270 N8S probably benign Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapl1 C A 2: 59,504,742 T80K possibly damaging Het
Ddx6 T C 9: 44,624,487 V171A probably damaging Het
Dnah12 C A 14: 26,772,594 T34K probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Ep400 T A 5: 110,733,897 probably benign Het
Erlin1 G T 19: 44,069,319 Y22* probably null Het
Gm11127 A T 17: 36,057,667 M123K probably damaging Het
Gm13212 T A 4: 145,617,177 probably null Het
Gm5771 T C 6: 41,396,767 L188P probably benign Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Ighv1-66 T A 12: 115,593,396 Q22L possibly damaging Het
Igkv4-80 T C 6: 69,016,736 Y57C probably damaging Het
Itpk1 G A 12: 102,570,157 A410V possibly damaging Het
Itsn1 T A 16: 91,820,583 probably benign Het
Kcnk3 G T 5: 30,588,386 A24S probably damaging Het
Kif20a A G 18: 34,632,611 Y887C probably damaging Het
Klf13 T C 7: 63,937,970 T193A possibly damaging Het
Klhl9 G T 4: 88,721,907 H32Q probably damaging Het
Kndc1 C G 7: 139,901,243 P82A probably damaging Het
Llgl1 T A 11: 60,712,082 L861Q probably damaging Het
Lpcat2 A G 8: 92,889,371 E305G probably damaging Het
Mib2 C A 4: 155,657,287 A293S probably damaging Het
Mtfr1 A G 3: 19,215,602 E138G probably damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ninj1 T A 13: 49,193,966 probably null Het
Nlgn2 A T 11: 69,834,278 V54E possibly damaging Het
Nlrc5 A C 8: 94,477,275 I668L probably damaging Het
Npy6r T A 18: 44,276,195 C228S probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Nup107 T C 10: 117,766,368 I513M probably benign Het
Oit3 T C 10: 59,425,462 D461G probably damaging Het
Olfr324 T A 11: 58,598,004 F205I probably benign Het
Paxbp1 T C 16: 91,034,123 D455G probably damaging Het
Pcdh7 A T 5: 57,721,283 T727S probably damaging Het
Pex14 G A 4: 148,970,596 A113V probably damaging Het
Phc3 A G 3: 30,965,882 V23A possibly damaging Het
Plec T C 15: 76,231,206 D56G possibly damaging Het
Plekha7 C A 7: 116,237,533 probably benign Het
Prdm16 T C 4: 154,337,683 E885G probably damaging Het
Psd2 A G 18: 36,012,828 T762A probably benign Het
Psme4 T A 11: 30,834,318 H964Q probably damaging Het
Rbak C T 5: 143,176,123 V51I probably benign Het
Rbfa A G 18: 80,200,506 L15P probably benign Het
Ren1 T C 1: 133,354,808 Y84H probably damaging Het
Rps6ka5 A T 12: 100,581,318 I311N probably damaging Het
Samd14 T A 11: 95,021,535 probably null Het
Scaf4 T C 16: 90,229,515 probably benign Het
Serpina12 A T 12: 104,038,352 L7Q unknown Het
Serpinb9d A T 13: 33,200,616 E192V probably damaging Het
Slc22a29 A T 19: 8,169,291 F382L probably benign Het
Snta1 T A 2: 154,378,115 D375V probably benign Het
Stat5b T A 11: 100,787,238 Y683F probably damaging Het
Strip1 A T 3: 107,624,503 Y257N probably benign Het
Sugp2 A G 8: 70,251,898 H695R probably benign Het
Svep1 T A 4: 58,068,526 R3087* probably null Het
Syngr2 T C 11: 117,813,121 V138A probably damaging Het
Thra T C 11: 98,764,484 F397L probably benign Het
Tmem45b T A 9: 31,428,655 I149F probably damaging Het
Tmprss11f C T 5: 86,539,694 probably null Het
Ush2a C T 1: 188,451,798 T1433I probably benign Het
Vmn2r109 A T 17: 20,554,558 Y178* probably null Het
Vmn2r84 T G 10: 130,390,713 M419L probably benign Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp276 A G 8: 123,268,406 probably benign Het
Zfp568 T G 7: 29,998,192 F100V probably benign Het
Zfp667 T A 7: 6,290,625 D41E possibly damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCCAAATGATACAAACCAGTG -3'
(R):5'- CTCAAGAAGCCACTTGGTCC -3'

Sequencing Primer
(F):5'- CAGTGTCAAGACCCTCAGTTAG -3'
(R):5'- AGAAGCCACTTGGTCCTTTTATTTTG -3'
Posted On2015-09-24