Incidental Mutation 'R4584:Slc22a29'
ID343970
Institutional Source Beutler Lab
Gene Symbol Slc22a29
Ensembl Gene ENSMUSG00000075044
Gene Namesolute carrier family 22. member 29
SynonymsD630002G06Rik
MMRRC Submission 041805-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4584 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8160165-8218900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8169291 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 382 (F382L)
Ref Sequence ENSEMBL: ENSMUSP00000152815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113298] [ENSMUST00000222533]
Predicted Effect probably benign
Transcript: ENSMUST00000113298
AA Change: F382L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108923
Gene: ENSMUSG00000075044
AA Change: F382L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.3e-25 PFAM
Pfam:MFS_1 140 372 7.7e-14 PFAM
Pfam:MFS_1 348 549 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140910
SMART Domains Protein: ENSMUSP00000117625
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 98 454 4.6e-20 PFAM
Pfam:MFS_1 137 462 3.6e-15 PFAM
low complexity region 467 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149182
SMART Domains Protein: ENSMUSP00000122262
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
Pfam:Sugar_tr 62 418 2.2e-20 PFAM
Pfam:MFS_1 101 427 1.9e-15 PFAM
low complexity region 431 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222533
AA Change: F382L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (86/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,160,017 N343D probably damaging Het
9530002B09Rik T A 4: 122,701,186 D78E possibly damaging Het
A2m C A 6: 121,657,406 D632E probably benign Het
Alpk2 A G 18: 65,306,964 S453P probably damaging Het
Birc2 A T 9: 7,833,674 F269I probably damaging Het
Ccdc66 G A 14: 27,500,511 P92S probably benign Het
Cdc34 T A 10: 79,688,035 D108E possibly damaging Het
Cdk5rap2 A C 4: 70,266,760 V1151G probably damaging Het
Cemip T C 7: 83,958,539 K753R probably damaging Het
Cep295 A T 9: 15,334,799 L787Q possibly damaging Het
Cideb T C 14: 55,758,270 N8S probably benign Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapl1 C A 2: 59,504,742 T80K possibly damaging Het
Ddx6 T C 9: 44,624,487 V171A probably damaging Het
Dnah12 C A 14: 26,772,594 T34K probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Ep400 T A 5: 110,733,897 probably benign Het
Erlin1 G T 19: 44,069,319 Y22* probably null Het
Gm11127 A T 17: 36,057,667 M123K probably damaging Het
Gm13212 T A 4: 145,617,177 probably null Het
Gm5771 T C 6: 41,396,767 L188P probably benign Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Ighv1-66 T A 12: 115,593,396 Q22L possibly damaging Het
Igkv4-80 T C 6: 69,016,736 Y57C probably damaging Het
Itpk1 G A 12: 102,570,157 A410V possibly damaging Het
Itsn1 T A 16: 91,820,583 probably benign Het
Kcnk3 G T 5: 30,588,386 A24S probably damaging Het
Kif20a A G 18: 34,632,611 Y887C probably damaging Het
Klf13 T C 7: 63,937,970 T193A possibly damaging Het
Klhl9 G T 4: 88,721,907 H32Q probably damaging Het
Kndc1 C G 7: 139,901,243 P82A probably damaging Het
Llgl1 T A 11: 60,712,082 L861Q probably damaging Het
Lpcat2 A G 8: 92,889,371 E305G probably damaging Het
Mib2 C A 4: 155,657,287 A293S probably damaging Het
Mtfr1 A G 3: 19,215,602 E138G probably damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ninj1 T A 13: 49,193,966 probably null Het
Nlgn2 A T 11: 69,834,278 V54E possibly damaging Het
Nlrc5 A C 8: 94,477,275 I668L probably damaging Het
Npy6r T A 18: 44,276,195 C228S probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Nup107 T C 10: 117,766,368 I513M probably benign Het
Oit3 T C 10: 59,425,462 D461G probably damaging Het
Olfr324 T A 11: 58,598,004 F205I probably benign Het
Paxbp1 T C 16: 91,034,123 D455G probably damaging Het
Pcdh7 A T 5: 57,721,283 T727S probably damaging Het
Pex14 G A 4: 148,970,596 A113V probably damaging Het
Phc3 A G 3: 30,965,882 V23A possibly damaging Het
Plec T C 15: 76,231,206 D56G possibly damaging Het
Plekha7 C A 7: 116,237,533 probably benign Het
Prdm16 T C 4: 154,337,683 E885G probably damaging Het
Psd2 A G 18: 36,012,828 T762A probably benign Het
Psme4 T A 11: 30,834,318 H964Q probably damaging Het
Rbak C T 5: 143,176,123 V51I probably benign Het
Rbfa A G 18: 80,200,506 L15P probably benign Het
Ren1 T C 1: 133,354,808 Y84H probably damaging Het
Rps6ka5 A T 12: 100,581,318 I311N probably damaging Het
Samd14 T A 11: 95,021,535 probably null Het
Scaf4 T C 16: 90,229,515 probably benign Het
Serpina12 A T 12: 104,038,352 L7Q unknown Het
Serpinb9d A T 13: 33,200,616 E192V probably damaging Het
Snta1 T A 2: 154,378,115 D375V probably benign Het
Stat5b T A 11: 100,787,238 Y683F probably damaging Het
Strip1 A T 3: 107,624,503 Y257N probably benign Het
Sugp2 A G 8: 70,251,898 H695R probably benign Het
Svep1 T A 4: 58,068,526 R3087* probably null Het
Syngr2 T C 11: 117,813,121 V138A probably damaging Het
Thra T C 11: 98,764,484 F397L probably benign Het
Tmem45b T A 9: 31,428,655 I149F probably damaging Het
Tmprss11f C T 5: 86,539,694 probably null Het
Ush2a C T 1: 188,451,798 T1433I probably benign Het
Vmn2r109 A T 17: 20,554,558 Y178* probably null Het
Vmn2r84 T G 10: 130,390,713 M419L probably benign Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp276 A G 8: 123,268,406 probably benign Het
Zfp568 T G 7: 29,998,192 F100V probably benign Het
Zfp667 T A 7: 6,290,625 D41E possibly damaging Het
Other mutations in Slc22a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc22a29 APN 19 8217813 missense probably benign 0.44
IGL00562:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00563:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00952:Slc22a29 APN 19 8217857 missense probably damaging 1.00
IGL01526:Slc22a29 APN 19 8207178 splice site probably benign
IGL01792:Slc22a29 APN 19 8218529 missense probably damaging 1.00
IGL02191:Slc22a29 APN 19 8218681 unclassified probably benign
IGL02391:Slc22a29 APN 19 8169353 missense probably benign 0.13
IGL02408:Slc22a29 APN 19 8207285 missense probably benign 0.00
IGL02957:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03059:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03299:Slc22a29 APN 19 8162648 critical splice donor site probably null
IGL03368:Slc22a29 APN 19 8207262 critical splice donor site probably null
R0017:Slc22a29 UTSW 19 8218266 splice site probably benign
R0105:Slc22a29 UTSW 19 8160627 unclassified probably benign
R0157:Slc22a29 UTSW 19 8162742 missense possibly damaging 0.61
R0265:Slc22a29 UTSW 19 8169970 missense probably benign 0.18
R1758:Slc22a29 UTSW 19 8217762 critical splice donor site probably null
R1918:Slc22a29 UTSW 19 8217759 splice site probably null
R1927:Slc22a29 UTSW 19 8207066 missense probably benign 0.01
R1959:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1960:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1961:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1966:Slc22a29 UTSW 19 8218408 missense probably damaging 1.00
R1968:Slc22a29 UTSW 19 8218343 missense probably benign 0.27
R1997:Slc22a29 UTSW 19 8217798 missense probably benign 0.00
R3105:Slc22a29 UTSW 19 8169973 missense probably benign 0.25
R3725:Slc22a29 UTSW 19 8218609 missense possibly damaging 0.78
R4118:Slc22a29 UTSW 19 8160529 unclassified probably benign
R4465:Slc22a29 UTSW 19 8162724 nonsense probably null
R4656:Slc22a29 UTSW 19 8218300 missense possibly damaging 0.90
R4679:Slc22a29 UTSW 19 8161584 missense possibly damaging 0.65
R4899:Slc22a29 UTSW 19 8161569 missense probably benign 0.00
R4913:Slc22a29 UTSW 19 8218358 missense probably benign 0.17
R5119:Slc22a29 UTSW 19 8217830 missense probably damaging 0.99
R5470:Slc22a29 UTSW 19 8161516 missense probably benign 0.01
R5474:Slc22a29 UTSW 19 8217857 missense probably damaging 1.00
R6794:Slc22a29 UTSW 19 8161523 missense probably benign 0.06
R6798:Slc22a29 UTSW 19 8160604 missense probably benign 0.16
R7025:Slc22a29 UTSW 19 8160580 missense probably benign
R7240:Slc22a29 UTSW 19 8161511 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTGGGGAGATAGCAGAAC -3'
(R):5'- GCCAAGACGCCTTCATAGTC -3'

Sequencing Primer
(F):5'- GGGAGATAGCAGAACTTTCTTTTTC -3'
(R):5'- GACGCCTTCATAGTCAAACTACTAG -3'
Posted On2015-09-24