Incidental Mutation 'R0064:Olfr714'
ID34403
Institutional Source Beutler Lab
Gene Symbol Olfr714
Ensembl Gene ENSMUSG00000049674
Gene Nameolfactory receptor 714
SynonymsGA_x6K02T2PBJ9-9453401-9454354, P4, MOR263-2
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107070981-107077802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107074280 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 151 (F151L)
Ref Sequence ENSEMBL: ENSMUSP00000151106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054629] [ENSMUST00000214429]
Predicted Effect probably benign
Transcript: ENSMUST00000054629
AA Change: F151L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095742
Gene: ENSMUSG00000049674
AA Change: F151L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.5e-56 PFAM
Pfam:7tm_1 42 291 3.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214123
Predicted Effect probably benign
Transcript: ENSMUST00000214429
AA Change: F151L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Olfr714
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Olfr714 APN 7 107074493 missense probably damaging 0.98
IGL02562:Olfr714 APN 7 107074562 missense probably benign 0.03
IGL02597:Olfr714 APN 7 107074439 missense possibly damaging 0.89
IGL02598:Olfr714 APN 7 107074716 missense possibly damaging 0.64
IGL02981:Olfr714 APN 7 107074551 missense probably damaging 1.00
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0518:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R0521:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R1661:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R1665:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R2069:Olfr714 UTSW 7 107074619 nonsense probably null
R2202:Olfr714 UTSW 7 107074316 missense probably damaging 1.00
R3884:Olfr714 UTSW 7 107073903 missense possibly damaging 0.72
R4362:Olfr714 UTSW 7 107074592 missense probably damaging 0.99
R4618:Olfr714 UTSW 7 107074554 missense probably damaging 1.00
R5375:Olfr714 UTSW 7 107073873 missense probably benign 0.05
R5654:Olfr714 UTSW 7 107074187 missense probably damaging 1.00
R6228:Olfr714 UTSW 7 107074136 missense probably damaging 1.00
R7196:Olfr714 UTSW 7 107074728 missense probably benign 0.01
R7202:Olfr714 UTSW 7 107074241 missense probably benign 0.01
R7232:Olfr714 UTSW 7 107073855 missense probably benign 0.03
Z1088:Olfr714 UTSW 7 107074405 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CATGCTGCAAAGCCCCATGTATTTC -3'
(R):5'- ATAGACCTCAAACCGGGCTGTGTC -3'

Sequencing Primer
(F):5'- TCATGGAGATCGGCTTCAAC -3'
(R):5'- TGTGTCTGCACAGACCAG -3'
Posted On2013-05-09